-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Kyra. J.E. Borgman, et al.,
bioRxiv - Immunology 2020
Quote:
... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
No products found
because this supplier's products are not listed.
Giuseppe Gangarossa, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ...
-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... ethyl ester (TMRE) (Abcam), and Mitotracker Greeen (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Connor S. Murphy, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and resuspended in tetramethylrhodamine ethyl ester (TMRE) buffer (Cayman Chemicals) containing 100 nM TMRE (Cayman Chemicals ...
-
Cat# HY-B0747-100 mg,
100 mg, USD $120.0
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ...
-
No products found
because this supplier's products are not listed.
Konstantinos Tassis, et al.,
bioRxiv - Biophysics 2020
Quote:
... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... or ethyl-3-4-dihydroxybenzoic acid (DHB, TCI America, Portland) and incubated with collagen (10 µg/ml ...
-
No products found
because this supplier's products are not listed.
Jung-Min Kim, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and TMRE (tetramethylrhodamine ethyl ester, Biotium, 70005), respectively ...
-
No products found
because this supplier's products are not listed.
Gergana Shipkovenska, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... treated with 3% ethyl methanesulfonate (EMS)(Winston ...
-
No products found
because this supplier's products are not listed.
R. Wercberger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a.
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
No products found
because this supplier's products are not listed.
Marie-Lynn Al-Hawat, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sulfo-cyanine 7 carboxylic acid was obtained from Lumiprobe (Cockeysville, MD). IRDye 680RD NHS Ester was obtained from LI-COR Biosciences (Lincoln ...
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
S. ter Horst, et al.,
bioRxiv - Microbiology 2022
Quote:
2’-Fluoro-2’-deoxycytidine (2’-FdC) (Biosynth-Carbosynth) was dissolved in 100% DMSO (VWR Chemicals) ...
-
No products found
because this supplier's products are not listed.
Jennifer Fransson, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (S)-Phosphoric acid mono-(2-octadec-9-enoylamino-3-[4-(pyridine-2-ylmethoxy)-phenyl]-propyl) ester (Ammonium Salt) (857340; Avanti Polar Lipids, Alabaster, Alabama, USA) was dissolved in 3% free-fatty acid BSA (FFA-BSA ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Shuai Xu, Yafeng Kang, Zhiqiang Liu, Hang Shi,
bioRxiv - Biophysics 2022
Quote:
... except that the carboxylic silica beads were replaced by polystyrene carboxylic beads and polyclonal anti-digoxigenin from sheep (11333089001, ROCHE) were used in our experiments.
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Wenjuan Yang, et al.,
bioRxiv - Immunology 2021
Quote:
... Caffeic acid phenethyl ester (CAPE) (R&D Systems), Mitoquinone (MitoQ ...
-
No products found
because this supplier's products are not listed.
Hengqian Ren, et al.,
bioRxiv - Biochemistry 2023
Quote:
... D-amino standards were generated by reacting the L-amino acid solution with 1-fluoro-2-4-dinitrophenyl-5-D-alanine amide (D-FDAA, Toronto Research Chemicals). These reaction products are enantiomers to the hypothetical D-amino acid and L-FDAA coupled products ...
-
No products found
because this supplier's products are not listed.
Jason Sims, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Niels Frimodt-Møller, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Djenet Bousbaine, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with 3-amino-9-ethyl-carbazole substrate (BD ELISPOT AEC Substrate Set) for 10 minutes and air-dried for at least 18 hours ...
-
No products found
because this supplier's products are not listed.
Suvadip Mallick, et al.,
bioRxiv - Microbiology 2019
Quote:
... 6-diamidino-2-phenylindole (Vector Laboratories Inc.) and observed under Zeiss Apotome microscope at the specified magnification ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Carlos A. Rodríguez-Salazar, et al.,
bioRxiv - Immunology 2023
Quote:
... or 2,5-Dimethyl-4-sulfamoyl furan-3-carboxylic acid (SFC) (Enamine US inc.) pCEBS and SFC were diluted to final concentrations of 200 ...
-
No products found
because this supplier's products are not listed.
Janine Vetter, et al.,
bioRxiv - Microbiology 2022
Quote:
... OxymaPure (hydroxyiminocyanoacetic acid ethyl ester) and DIC (N,N’-diisopropyl carbodiimide) were purchased from Iris Biotech GMBH ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Mohamad Javad Norahan, et al.,
bioRxiv - Biophysics 2021
Quote:
The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Cagney Coomer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Brian J. Thomas, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
No products found
because this supplier's products are not listed.
Mateusz Stoszko, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... caffeic acid phenethyl ester (CAPE, MP Biomedicals), and Romidepsin (RMD ...
-
No products found
because this supplier's products are not listed.
Anandita Pal, et al.,
bioRxiv - Biochemistry 2020
Quote:
... diet in the absence or presence of EPA (Cayman, >93%) ethyl esters (Envigo TD.160232) for 15 weeks ...
-
No products found
because this supplier's products are not listed.
Reetesh Kumar,
bioRxiv - Microbiology 2020
Quote:
... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
No products found
because this supplier's products are not listed.
Jeffrey L. Platt, et al.,
bioRxiv - Immunology 2021
Quote:
... The reaction was visualized by subsequent addition of 2,2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate (Southern Biotech, #0202-01).
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Aidan Pavao, et al.,
bioRxiv - Microbiology 2023
Quote:
... Ethyl [U-13C]2-hydroxybutyrate (Cambridge Isotope Laboratories, Inc.) approximated 2-hydroxybutyrate and 2-aminobutyrate signals ...