-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Yakun Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... We also used archived normal NHP tissue lung sections (from one rhesus macaque and one cynomolgus macaque) purchased from Zyagen (San Diego, CA) as controls.
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Ty S. Maughon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and one induced pluripotent stem cell derived MSC cell-line (Cellular Dynamics International, Madison WI) (Lot #0003 ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Martín Klappenbach, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... followed by a variable period of time during which the animal was presented with one pellet of food (Bottom fish, Labcon) at the bottom of the container in the center of the StQ ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Alec W. Stranahan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or Ara-C (LKT Laboratories, cat no: 147-94-4). For combination treatment studies with Zileuton (LKT Laboratories ...
-
No products found
because this supplier's products are not listed.
Victoriane Peugnet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... from which a low voltage alternating current (20 mV) is generated in the culture medium from one electrode to another by an iCELLingence system (00380601000, ACEA Biosciences). The electrical resistance of adherent cells (RCell ...
-
No products found
because this supplier's products are not listed.
Wouter H. van Megen, et al.,
bioRxiv - Physiology 2021
Quote:
... and one group received infusion with 20 mg/ml etelcalcetide hydrochloride via Alzet osmotic 2001 minipumps (Durect Corporation, Cupertino, CA, USA) with a delivery rate of 1.0 μl/hr ...
-
No products found
because this supplier's products are not listed.
Kärt Mätlik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cerebella were soaked in the DNA for 15-20 minutes on ice and were transferred one at a time into the well of an electroporation chamber (Protech International Inc ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Jonathan M. Warawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... Neutropenia (>90% depletion) was confirmed by complete blood cell counts one day prior to infection using a Hemavet 950 (Drew Scientific, Miami Lakes, FL). Group sizes for all studies were 10 animals ...
-
Cat# CP-LMK-009,
inquiry, contact supplier for pricing
Ask
J. M. Kirkland, et al.,
bioRxiv - Neuroscience 2023
Quote:
Homogenate from two sex- and manipulation-matched rats were pooled into one sample for proteomic analysis carried out by Creative Proteomics (https://www.creative-proteomics.com/).
-
No products found
because this supplier's products are not listed.
Justin Riddle, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The P4 (4-pregenen-3,20-dione) enzyme immunoassay kit was provided by Salimetrics Inc (State College ...
-
No products found
because this supplier's products are not listed.
Daniel C. Akuma, et al.,
bioRxiv - Immunology 2022
Quote:
... supernatants were diluted 4-fold and applied to Immulon ELISA plates (ImmunoChemistry Technologies) pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
Africa Fernandez-Nasarre, et al.,
bioRxiv - Immunology 2023
Quote:
... Keratinocytes were cultured in an incubator at 5% CO2 at 35°C in 6-well plates (Falcon) coated with PureCol bovine collagen I solution (Cell Systems) in low calcium homemade culture medium containing recombinant mEGF (Peprotech ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...
-
No products found
because this supplier's products are not listed.
Natsumi Takei, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... eluted with elution buffer (4% BrdU/DMSO solution in nuclease-free PBS; MBL International), and subjected to SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Daphne Bazopoulou, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Worms were mounted on objective slides using 4 μl thermoreversible CyGEL (BioStatus; Fisher Scientific) and 2 μl of 50 mM levamisole for immobilization ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Steven T. Denham, et al.,
bioRxiv - Microbiology 2022
Quote:
... neoformans cells in 500 μl of 0.01% Direct Yellow 96 (AK Scientific 61725-08-4), vortexing briefly to mix ...
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 12.5 μL of the FXa substrate RGR-XaChrom (4 mM, Enzyme Research Laboratories#100-03) was added and the mixture was incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Zachary B. Hancock, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Raegan Paul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... temperature and pH were measured directly in the fluids using a portable YSI Plus 6-Series Sonde Multimeter (YSI Incorporated, Yellow springs, OH) and 0.5 to 1.5 liters of hydrothermal fluids venting from the subsurface were collected ...
-
No products found
because this supplier's products are not listed.
Jacqueline Grimm, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Membranes were then incubated overnight at 4 °C with anti-LPS antibody (1:400,000; Hycult Biotech) in milk ...
-
No products found
because this supplier's products are not listed.
Embriette R. Hyde, Hiram Lozano, Steven Cox,
bioRxiv - Microbiology 2020
Quote:
... Chilled (4°C) and pre-reduced anaerobically sterilized (PRAS) dilution blank medium (AS-9183, Anaerobe Systems) was added at a volume of 2:1 (2mL per gram ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
Creatinine Serum assay Kit
Cat# KB02-H2,
1.0 ea, USD $385.0
Ask
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
The serum progesterone levels (n=4) were measured using an ELISA assay (# K025-H1/H5 Arbor Assays, Ann Arbor ...
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Megan K. DeBari, et al.,
bioRxiv - Bioengineering 2021
Quote:
Media was collected on day 4 and glycerol concentrations were measured using a glycerol assay (BioAssay Systems, Hayward, CA). The assay was performed following the manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an overnight incubation at +4°C with anti-OVA257-264 Dextramer PE conjugate (SIINFEKL, IMMUDEX, Virum Denmark) diluted 1:30 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Wenxu Zhang, et al.,
bioRxiv - Bioengineering 2022
Quote:
De-identified human kidney tissue sections (30μm) were prepared from 4% v/v PFA-fixed frozen biopsy samples using a Compresstome (VF-210-0Z, Precisionary). Samples were imaged between 1mm thick glass slide and #1 thickness coverglass ...
-
No products found
because this supplier's products are not listed.
Simon A. Fromm, et al.,
bioRxiv - Biochemistry 2020
Quote:
Fluorimetry experiments were performed using a FluoroMax-4 instrument (Horiba) and a quartz cuvette compatible with magnetic stirring (Starna Cells) and a 10 mm pathlength ...
-
No products found
because this supplier's products are not listed.
Adil R Wani, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4 transgenic lines were identified through the loss of y and were PCR-tested for orientation of insertion by Bestgene. We then tested these lines for expression of TdTomato and gene disruption after conditional expression of FLP Recombinase (Figure S3A-D) ...
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...