-
No products found
because this supplier's products are not listed.
Valeria Rudman-Melnick, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... UIR and UUO whole kidney lysates (n=4-6 per group) with RNA Stat-60 extraction reagent (Amsbio, CS-111) and purified using the GeneJET RNA purification kit (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Guillem Casadevall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Crystals appeared within one day from the Index HT screen from Hampton Research Inc ...
-
Derivatization reagent
Sold for research purposes only.
Cat# 1877.0, SKU# 1877-25 mg,
25mg, US $522.50 / EA, EURO, €475 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 4: (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (LysN3, Iris Biotech GmBH); 5 ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Tomoya Sasahara, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Counterstaining was carried out with 4’,6-diamidino-2-phenylindole (DAPI, 1:500; Dojindo Molecular Technologies, Kumamoto, Japan). Fluorescence images were acquired with a confocal laser-scanning microscope LSM710 (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Cristóbal Gallegos, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Sequencing was performed in two batches, one by GenomeQuébec (Montréal, Canada) and one by GENEWIZ (Suzhou, China). Both batches used one lane of Illumina HiSeq 4000 (paired-end ...
-
No products found
because this supplier's products are not listed.
Isabella Vlisidou, et al.,
bioRxiv - Microbiology 2019
Quote:
... were added to one BioPORTER tube (Genlantis) and resuspended in 920 μl of DMEM ...
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Anastasiya Sybirna, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 6-well EZSPHERE microplates (ReproCELL) were used (500,000 cells/well in 3 mL PGCLC medium) ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6-fluorotryptamine (AstaTech, Catalog #W10003), 7-fluorotryptamine hydrochloride (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... Flow-chambers were assembled from one glass slide and one coverslip separated by double-sided 0.12 mm tape (Grace Bio-labs) positioned between each hole in the glass slide ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Cody Moore, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or recombinant ATF-6 Beta (Abnova H00001388-Q01). Wild-type HEK293T lysate (Origene LY500001 ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... followed by a one-week selection with puromycin (AdipoGen AG, Liestal, CH) 1.5 µg/mL ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Xiaodong Duan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Each drive was loaded with closely aligned one optical fiber (230 um, RWD Life Science) and 4 tetrodes ...
-
No products found
because this supplier's products are not listed.
Jiapeng Deng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one containing horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibodies (1:5000, Bioworld, Atlanta, GA, USA) and the other containing HRP-conjugated goat anti-rabbit antibodies (1:5000 ...
-
No products found
because this supplier's products are not listed.
Alfredo Zuniga, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Sections labeled for only one IEG were incubated with 1:2000 chicken anti-GFP (Aves Labs) and either 1:2000 rabbit anti-Fos (Synaptic Systems ...
-
No products found
because this supplier's products are not listed.
Qin Luo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... standard fluorescence detector (4 photomultiplier tubes (PMT) and 6 filter cubes) ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 12-port valves (IDEX, EZ1213-820-4) and a peristaltic pump (Gilson ...
-
No products found
because this supplier's products are not listed.
Na Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... from one week before surgery until sacrifice using a tail-cuff based CODA high throughput system (Kent Scientific Corporation).
-
No products found
because this supplier's products are not listed.
W. Grant Ludlam, et al.,
bioRxiv - Biochemistry 2019
Quote:
The BBS2-7-9 complex was purified at 4°C by affinity purification using 4 mL of Strep-Tactin resin (IBA Life Sciences) packed in a 2 cm diameter column and equilibrated with equilibration buffer (20 mM HEPES pH 7.5 and 20 mM NaCl) ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 4 mL 5× PEG reagent (System Biosciences, LV825A-1) was added and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Daniel Rüdiger, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a 4 mg/ml collagen I gel (produced according the protocol) and a 6 mg/ml laminin gel (Trevigen, Gaithersburg, USA) were mixed on ice ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Emily E Whittle, et al.,
bioRxiv - Microbiology 2021
Quote:
... One assay used MOPs minimal media (Teknova) which was supplemented with 400 mg/L histidine.
-
No products found
because this supplier's products are not listed.
Jennifer M. Achiro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... one hippocampus was homogenized with a Dounce tissue grinder (Wheaton 357544) in 2 mL HB buffer (1 mM DTT ...
-
No products found
because this supplier's products are not listed.
Shih-Heng Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... pAAV2/6 (Cell Biolabs Inc., Cat# VPK-426), pAAV2/8 (Cell Biolabs Inc. ...
-
No products found
because this supplier's products are not listed.
Silvia Ferrara, et al.,
bioRxiv - Microbiology 2020
Quote:
... The lungs were washed with three one ml of RPMI-1640 (Euroclone) with protease inhibitors (Complete tablets ...
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 6-(Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite was purchased from Glen Research (CAS: 133975-85-6; Glen Research Cat. # 10-1916). Each synthesis cycle was used to add one nucleotide and consisted of the following steps ...
-
No products found
because this supplier's products are not listed.
Vivian K. Chen, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... Clotrimazole 6 µM (or 2 mg/L, Chem-Impex International #01311) were performed with 48 hour transfers at Stanford ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... Liposomes containing either PI(4)P (Echelon Biosciences) or PI(4,5)P2 (Echelon Biosciences ...