1 - 50 of 632
suppliers found for
6 FLUORO 2 METHYLQUINOLINE 3 CARBOXYLIC ACID
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-W027968-100 mg, 100 mg, USD $50.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018Quote: Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Sigma-Aldrich 23881-3) is a powerful antioxidant water-soluble vitamin E analogue ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2017, published in Synthetic Biology doi: 10.1093/synbio/ysy016Quote: ... 5-(and-6)-carboxylic acid (Invitrogen, USA). The dye was dissolved in DMSO at 1 mM and stored at +4° C ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 6-Isopropoxy-9-xanthone-2-carboxylic acid (AH6809, 10 µM, Tocris); N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251 ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 14-eicosatrienoic acid (20:3 ω-6, sciadonic acid; Cayman Chemical, # 10009999), all cis-8 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2019, published in Biophysical Journal doi: 10.1016/j.bpj.2019.08.005Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck). -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... gasderminC-2/-3 (Rabbit monoclonal; 229896; Lot# GR3317481-6; abcam), gasdermin D (Rabbit polyclonal ... -
MedChemExpress
Cat# HY-W027968-100 mg, 100 mg, USD $50.0 AskbioRxiv - Immunology 2020Quote: ... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Sections were incubated in 4’,6-diamidino-2-phenylindole (DAPI) and mounted onto slides with Fluoro-Gel fluorescence mounting medium (Electron Microscopy Sciences Cat# 1798502). Expression was observed via confocal microscopy. -
Fluorochrome
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a. -
VWR
No products found because this supplier's products are not listed.Cited in GUN1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesisbioRxiv - Plant Biology 2020Quote: 1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in Novel strategy for treating neurotropic viral infections using hypolipidemic drug AtorvastatinbioRxiv - Microbiology 2019Quote: ... 6-diamidino-2-phenylindole (Vector Laboratories Inc.) and observed under Zeiss Apotome microscope at the specified magnification ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Scientific Reports doi: 10.1038/s41598-019-42592-1Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Scientific Reports doi: 10.1038/s41598-020-62089-6Quote: ... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... IL-3 and IL-6 (PeproTech). After 48 hours culture ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Geometry alone influences stem cell differentiation in a precision 3D printed stem cell nichebioRxiv - Bioengineering 2018Quote: ... Hydrochloric acid (3 mL, 6N, Alfa Aesar, UK, 44921) was added and the solution incubated at 80°C for one hour to dissolve any insoluble matter ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 19-docosahexaenoic acid (22:6 ω-3, DHA, Tokyo Chemical Industry/TCI, Tokyo, Japan, #D2226). The FA standards were dissolved in a solution containing two volumes of chloroform and one volume of methanol with 0.05% (w/v ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... 6 - trisulfonic acid (ProZyme, Inc., San Leandro, CA) at the reducing termini by reductive amination ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Structural and functional insights into nitrosoglutathione reductase from Chlamydomonas reinhardtiibioRxiv - Plant Biology 2020Quote: ... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Stem Cells International doi: 10.1155/2019/6041816Quote: ... 3 and 6 were stained with Calcein-AM (BIOLEGEND, 425201) and PI (SIGMA ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in PLOS Biology doi: 10.1371/journal.pbio.3000471Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ... -
Bangs Laboratories
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ... -
IRIS Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem. -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Angewandte Chemie doi: 10.1002/ange.201914449Quote: ... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Frontiers in Neuroscience doi: 10.3389/fnins.2019.00201Quote: ... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... The reaction was visualized by subsequent addition of 2,2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate (Southern Biotech, #0202-01). -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in RAB6 GTPase is a crucial regulator of the mammary secretory function controlling STAT5 activationbioRxiv - Developmental Biology 2020Quote: ... fixed in Methacarn (1/3/6 mixture of acetic acid/chloroform/methanol) overnight at room temperature and stained with carmine alum (Stem Cell Technologies), or fixed in 4% paraformaldehyde overnight at 4°C ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 6 (3M and 6M, mIPSCs), respectively. -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ... -
Bio-Rad
No products found because this supplier's products are not listed.Cited in Proteasomal Inhibition Triggers Viral Oncoprotein Degradation via Autophagy-Lysosomal PathwaybioRxiv - Cancer Biology 2019, published in PLOS Pathogens doi: 10.1371/journal.ppat.1008105Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ... -
PerkinElmer
No products found because this supplier's products are not listed.Cited in Improving drug discovery using image-based multiparametric analysis of epigenetic landscape.bioRxiv - Cell Biology 2019, published in eLife doi: 10.7554/eLife.49683Quote: GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2022Quote: ... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ... -
United States Biological
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... 5-fluoro-orotic acid monohydrate (#F5050, United States Biological, Salem, MA) was added to modified YC medium (1 g/L Pro in place of ammonium sulfate ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... on Fluoro-Dish glass bottom dishes (World Precision Instruments). Images were acquired using a Leica DFC7000T camera mounted on a Leica M165FC stereomicroscope and LAS X software (Leica). -
Envigo RMS
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkaa042Quote: ... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... and Alexa fluoro-568 conjugated a-bungarotoxin (1:500, Biotium 00006) for 3 hours at room temperature ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...