-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Rohit Singh Rawat, et al.,
bioRxiv - Neuroscience 2022
Quote:
... isolated from hypothalamus and PFC of F0 and F1 male mice was diluted in immunoprecipitation buffer and incubated with 2 μg 5-methyl cytosine antibody (A-1014; Epigentek) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Dieter Waschbüsch, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The gel was then stained for 1h using Instant Blue Coomassie (Expedeon). Protein concentrations were adjusted using the upper protein band ...
-
No products found
because this supplier's products are not listed.
Hiroe Suda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... TSK gel ODS-100V (2 mm ID x 150 mm, 3 µm, Tosoh, Tokyo, Japan). The column was eluted with a linear gradient from 30 to 90% mobile phase B (0.1% formic acid in acetonitrile ...
-
No products found
because this supplier's products are not listed.
Alejandro Villalba, et al.,
bioRxiv - Immunology 2023
Quote:
... were stimulated as described [6] in flat-bottom 96 well plates with a soluble anti-CD3 IgE subclass (T3/4.E, Sanquin, Amsterdam ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Stephen B. McHugh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were then incubated with primary antibodies diluted in 3% NDS blocking solution and incubated at 4 °C for 72 hours (GFP anti-chicken, 1:1,000, Aves Labs, catalog no ...
-
No products found
because this supplier's products are not listed.
Mariève D. Boulanger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB, #BC24, G-Biosciences) in phosphate buffered saline solution (PBS ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Shih-Heng Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... pAAV2/6 (Cell Biolabs Inc., Cat# VPK-426), pAAV2/8 (Cell Biolabs Inc. ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike (BPS Bioscience) and p24 (Abcam ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The BC-1471 compounds (TargetMol, CAS 896683-84-4 and CAS 896683-78-6) were also evaluated with STAMBPJAMM under identical conditions with a final concentration of 1 μM ...
-
No products found
because this supplier's products are not listed.
Jana Schuettpelz, et al.,
bioRxiv - Cell Biology 2024
Quote:
... cells were incubated with 100 nM CCCP for 1h or Ink128 (MLN0128, AdooQ) for 24 h.
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Jin Gao, et al.,
bioRxiv - Microbiology 2020
Quote:
... Zanamivir and 2’-(4-methylumbelliferyl)-α-d-N-acetylneuraminic acid (MUNANA) were acquired from Moravek Inc and Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Tomáš Urban, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Tissue fragments were then homogenized by 5-6 slow strokes up and down with 2 mL Potter-Elvehjam teflon/glass homogenizer (clearance 0.25 mm; Wheaton™, Millville, USA) driven by electric motor homogenizer (750 rpmi ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
The following primary antibodies were incubated in PBS at 4 °C overnight: Mouse anti-DSG1/2 (61002, Progen), mouse anti-DSP (61003 ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
A.K. Sulit, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2/1/56 FAA), and Porphyromonas asaccharolytica (CC44 001F, and CC1/6 F2) using Bacterial Lipopolysaccharides (LPS) Extraction Kit (Alpha Diagnostic International, Catalog # 1000-100-LPS) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Carolina Rosselot, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Exendin-4 plasma levels were measured using the exendin-4 EIA kit (Phoenix pharmaceuticals, Burlingame, CA). Harmine was measured in plasma by liquid chromatography–mass spectrometry analysis by WuXi AppTec (Cranbury ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Uwe Schwartz, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 hpi using TRI Reagent (Molecular Research Center, Inc.). Two time series sets of total RNA were prepared from two independent infections ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...