-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Daniel J. Steiner, et al.,
bioRxiv - Immunology 2020
Quote:
Arrays were printed on amine-reactive silicon oxide substrates (Adarza BioSystems, Inc.) using a Scienion SX piezoelectric microarrayer (Scienion, A.G.) with spot volumes of approximately 300 pL ...
-
No products found
because this supplier's products are not listed.
Julie Van Coillie, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 levels in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) using IL-6 CT205-c and CT205-d antibody pair (U-CyTech, Utrecht, the Netherlands) as described previously (1).
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Ritesh Tandon, et al.,
bioRxiv - Microbiology 2020
Quote:
... chondroitin sulfate D (CS-D, Mw = 20 kDa) from whale cartilage (Seikagaku, Tokyo, Japan) and chondroitin sulfate E (CS-E ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
Mouse monoclonal antibody specific for HSV Glycoprotein D
Cat# MAB12121-200,
200µg USD $483.6
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Li Du, et al.,
bioRxiv - Microbiology 2022
Quote:
Assessment of Gal-9 effects on the binding of the SARS-CoV-2 spike to human ACE2 was performed using a commercially available spike-ACE2 binding assay kit (CoviDrop SARS-CoV-2 Spike-ACE2 Binding Activity/Inhibition Assay Kit, EPIGENTEK, D-1005-48) following the protocol provided by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Abdoulie O. Touray, et al.,
bioRxiv - Microbiology 2023
Quote:
... Membranes were probed for 2 h at RT (or overnight at 4°C) with mAb α-V5 (BioShop Canada Inc., catalog number TAG006.100) 1:2,500 in 6% milk in PBS 0.05% Tween (PBS-T) ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... 12 g Sfär C18 D Duo column (Biotage). Water with 0.1% (v/v ...
-
No products found
because this supplier's products are not listed.
Fiona E. Serack, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and incubated in 100 μL D-luciferin (Syd Labs) in PBS at a concentration of 1.25 mg/mL ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 50 nm gold particles (BBI Solutions, EM.GC50/4). Fixation was performed using a buffer made from ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Britta Lötstedt, et al.,
bioRxiv - Genomics 2022
Quote:
... six spatial microarrays were created on amine-activated Codelink slides (Surmodics, USA). Printing was performed by ArrayJet LTD (Scotland ...
-
[D-Lys3]- GHRP- 6 is a peptide.
Cat# abx266032-25MG,
25 mg USD $710.5
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
Cat# 879873-49-1,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Daan Vorselen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and streptavidin (Neuromics, 2-0203-100) in PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The hLeptin:hLEP-RCRH2 complex (6 mg/mL) was subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format ...