-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Edward A Meyer, Craig E Franklin, Rebecca L Cramp,
bioRxiv - Zoology 2020
Quote:
... gill arches and tail sections from acid naïve and acid acclimated larvae (N = 3 for each group) were mounted on stubs and coated with gold in a sputter coater (SPI Module; SPI Supplies, West Chester, PA, USA). Gills and tail sections were viewed and photographed with a Jeol JSM 6400 SEM.
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
Cat# F3,
USD $18.00/EA
Ask
Michael P. Vincent, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Fmoc-N-amido-dPEG24-amido-dPEG24-acid (Quanta Biodesign) were purchased for use in the synthesis of the PG6 ...
-
No products found
because this supplier's products are not listed.
Hyunjun Yang, Adam G. Kreutzer, James S. Nowick,
bioRxiv - Microbiology 2023
Quote:
... Fmoc-N-Me-D-Gln(Trt)-OH was purchased from ChemPep. Other protected amino acids were purchased from CHEM-IMPEX ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the N-terminal tag was removed by incubation with HRV 3C protease (AG Scientific) and further purified by Superose 6 column ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Margaret E. Torrence, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 30 min prior to stimulation with vehicle (water) or 500 nM insulin (Alpha Diagnostic, INSL 16-N-5) for 16 h or treated with vehicle (DMSO ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Anno Saris, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-RBD and anti-NP IgG antibodies were measured in EDTA plasma samples at 100-1200 fold dilutions using ELISA as previously described.11 Plates were coated with RBD or N protein and specific IgG antibodies were detected using anti-human IgG (MH16, Sanquin).
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Kantak, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The 3-inch ballpoint sipper tube with a 1-inch bend (Ancare Corp., Bellmore, NY, USA) protruded 3.6 cm into the chamber ...
-
No products found
because this supplier's products are not listed.
Thomas A. Packard, et al.,
bioRxiv - Cell Biology 2021
Quote:
HLAC cells were stimulated for 3 days with plates coated with 10 µg/mL anti-CD3 (UCHT1, Tonbo Biosciences) and 10 µg/mL anti-CD28 (CD28.2 ...
-
No products found
because this supplier's products are not listed.
Nao Nishida-Aoki, Taranjit S. Gujral,
bioRxiv - Cancer Biology 2021
Quote:
Jurkat cells were washed with PBS and seeded onto a 24-well transwell culture insert with 3 µm pores (Celltreat Scientific Products ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Physiology 2020
Quote:
... or rec N-Shh (Shenandoah biotechnology) diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Valentin Gfeller, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Each plot was 6 m long and 3 m wide and separated from each other by 3 m of buffer of alfalfa (Medicago sativa). Maize was grown from Mai to September 2018 followed by wheat from October to July 2019 ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Thibault Colombani, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Acrylate-PEG-N-hydroxysuccinimide (3.5 kDa) was purchased from JenKem Technology (Plano, TX, USA). ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville ...
-
No products found
because this supplier's products are not listed.
Daisuke Ogasawara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... N-term strep-His tag was first inserted into phCMV3 vector (Genlantis, cat # P003300) using Q5® Site-Directed Mutagenesis Kit (New England BioLabs ...
-
No products found
because this supplier's products are not listed.
Alicia C. Strtak, et al.,
bioRxiv - Microbiology 2019
Quote:
... Mammalian expression vectors were generated by inserting c-myc tag and mRuby3 red fluorescent protein upstream of full length NS1-2 and then subcloning this into the pTagRFP-N vector in place of TagRFP (Epoch Life Sciences, Missouri City, TX). This construct will be referred to as RFP-NS1-2 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jennifer Hsiao-Nakamoto, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Corresponding brain sections from age and sex matched non-carrier controls (n=15) were purchased from BioIVT. A demographic summary is provided in Table 2.
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...