-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Brandon J. Berry, et al.,
bioRxiv - Physiology 2019
Quote:
... ethyl ester (TMRE, ThermoFisher, T669) was added to observe mitochondrial membrane potential in quench mode ...
-
No products found
because this supplier's products are not listed.
Gergana Shipkovenska, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... treated with 3% ethyl methanesulfonate (EMS)(Winston ...
-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... ethyl ester (TMRE) (Abcam), and Mitotracker Greeen (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Carlos Perez, et al.,
bioRxiv - Neuroscience 2020
Quote:
NNC-711 (1,2,5,6-Tetrahydro-1-[2-[[(diphenylmethylene)amino]oxy]ethyl]-3-pyridinecarboxylic acid hydrochloride) from Tocris
-
No products found
because this supplier's products are not listed.
Fadilah Fadilah, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... or ethyl-3-4-dihydroxybenzoic acid (DHB, TCI America, Portland) and incubated with collagen (10 µg/ml ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 500 µl of ethyl acetate (ethyl acetate; VWR) following which they were centrifuged at 500g at RT for 15 min ...
-
No products found
because this supplier's products are not listed.
Connor S. Murphy, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and resuspended in tetramethylrhodamine ethyl ester (TMRE) buffer (Cayman Chemicals) containing 100 nM TMRE (Cayman Chemicals ...
-
Cat# HY-B0747-100 mg,
100 mg, USD $120.0
Ask
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Valsartan ethyl ester was obtained from MedChemExpress. 3-hydroxy-3-methylglutaric acid (HMG ...
-
No products found
because this supplier's products are not listed.
Jung-Min Kim, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and TMRE (tetramethylrhodamine ethyl ester, Biotium, 70005), respectively ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
Lea C. Neelsen, et al.,
bioRxiv - Biophysics 2023
Quote:
... (2-(Trimethylammonium)ethyl) MethaneThioSulfonate Chloride (MTS-ET) (Toronto Research Chemicals, USA) was directly dissolved to the desired concentration of 1.0 mM in the intracellular recording solution prior to each experiment ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Kai Guo, et al.,
bioRxiv - Immunology 2022
Quote:
... in DMEM containing 0.0002% L-1-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical) with antibiotics ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Aidan Pavao, et al.,
bioRxiv - Microbiology 2023
Quote:
... Ethyl [U-13C]2-hydroxybutyrate (Cambridge Isotope Laboratories, Inc.) approximated 2-hydroxybutyrate and 2-aminobutyrate signals ...
-
No products found
because this supplier's products are not listed.
Sanjana Mahadev-Bhat, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Ethyl pyruvate (EP) purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Djenet Bousbaine, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with 3-amino-9-ethyl-carbazole substrate (BD ELISPOT AEC Substrate Set) for 10 minutes and air-dried for at least 18 hours ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phospho((ethyl-1’,2’,3’-triazole)triethyleneglycolmannose) (ammonium salt) (PA-PEG3-mannose) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Linoleic acid (LA) ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Viviane S. De Paula, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 5% (v/v) glycerol and 1 mM Tris(2-carboxy-ethyl) phosphine (TCEP) containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
No products found
because this supplier's products are not listed.
Marie-Lynn Al-Hawat, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sulfo-cyanine 7 carboxylic acid was obtained from Lumiprobe (Cockeysville, MD). IRDye 680RD NHS Ester was obtained from LI-COR Biosciences (Lincoln ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Janine Vetter, et al.,
bioRxiv - Microbiology 2022
Quote:
... OxymaPure (hydroxyiminocyanoacetic acid ethyl ester) and DIC (N,N’-diisopropyl carbodiimide) were purchased from Iris Biotech GMBH ...
-
No products found
because this supplier's products are not listed.
Mohamad Javad Norahan, et al.,
bioRxiv - Biophysics 2021
Quote:
The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Anandita Pal, et al.,
bioRxiv - Biochemistry 2020
Quote:
... diet in the absence or presence of EPA (Cayman, >93%) ethyl esters (Envigo TD.160232) for 15 weeks ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... [[[(1S)-1-(4-Bromophenyl)ethyl]amino](1,2,3,4-tetrahydro-2,3-dioxo-5-quinoxalinyl)methyl] phosphonic acid tetrasodium salt (PEAQX; HelloBio).
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Cagney Coomer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
No products found
because this supplier's products are not listed.
B. Afzali, et al.,
bioRxiv - Immunology 2019
Quote:
... and for ubiquitination reactions 5mM N-ethyl maleimide (NEM, Calbiochem) was included ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Jason Sims, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Niels Frimodt-Møller, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Mikala C. Mueller, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Ethyl 2-(bromomethyl)acrylate (EBrMA; Ambeed, Inc.) was added drop-wise at a 6x molar ratio to PEG-OH groups ...
-
No products found
because this supplier's products are not listed.
Hana M. Zegallai, et al.,
bioRxiv - Immunology 2021
Quote:
... Ethyl Ester (TMRE) mitochondrial membrane potential assay kit (Catalog no. K238) from BioVision Inc ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Reetesh Kumar,
bioRxiv - Microbiology 2020
Quote:
... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Suvadip Mallick, et al.,
bioRxiv - Microbiology 2019
Quote:
... 6-diamidino-2-phenylindole (Vector Laboratories Inc.) and observed under Zeiss Apotome microscope at the specified magnification ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...