-
No products found
because this supplier's products are not listed.
Srideshikan Sargur Madabushi, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The mouse and humanized anti-human CD33 mAb were conjugated with the metal chelator 1,4,7,10-tetraazacyclododecane-N,N′,N′′,N′′′-tetraacetic acid (NHS-DOTA; Macrocyclics, Dallas, TX) as previously described (12) ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... Id3 (1:1000; 6-1, CalBioreagents), Usp1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Marina Chan, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Recombinant purified N-terminal domain (NTD) of the SARS-CoV-2 was obtained from Leinco Technologies Inc (Cat #S853 ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
Cat# IT-52-250,
250 micrograms,USD $2400.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... anti-p75 conjugated saporin (p75-saporin) or IgG-saporin control (n = 8 / group, Advanced Targeting Systems) was diluted to final concentration of 0.4 mg/ml in normal saline ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Jennifer McDonald, Catherine J. Merrick,
bioRxiv - Microbiology 2021
Quote:
Mature schizont cultures at >6% parasitaemia were synchronised using 55% Nycodenz (Alere technologies AS). Cultures were centrifuged and media removed to leave 2ml of media and blood ...
-
No products found
because this supplier's products are not listed.
KR Bowles, et al.,
bioRxiv - Neuroscience 2023
Quote:
Monomeric recombinant tau of each of the 6 major isoforms was purchased from rPeptide, and was labelled using the pHrodo Red Microscale Protein Labeling kit (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
PBMCs from healthy donors were purchased from HemaCare (PB009C-3). To generate IKZF3-deficient CAR-T cells ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Caroline S. Cencer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CL4 and CACO-2BBE cells were grown to n days post-confluent (DPC) on acid-washed 22×22 mm #1.5H coverslips (Globe Scientific) in a 6-well plate to a time point with apical polarity representative of their native tissue ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Africa Fernandez-Nasarre, et al.,
bioRxiv - Immunology 2023
Quote:
... Keratinocytes were cultured in an incubator at 5% CO2 at 35°C in 6-well plates (Falcon) coated with PureCol bovine collagen I solution (Cell Systems) in low calcium homemade culture medium containing recombinant mEGF (Peprotech ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Neha Ahuja, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Genotypes were determined by polymerase chain reaction (PCR) after O/N digestion using DirectPCR (Tail) Lysis buffer (Viagen, Los Angeles, CA) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Satoru Hoshino, et al.,
bioRxiv - Zoology 2021
Quote:
We measured the body mass of all animals before and after the sampling periods in each experiment (N. larvatus: Digital Platform Scale, DP-8100, Yamato, Japan; T. cristatus: SD75LJP, OHAUS Corporation, USA), by offering weighing platforms on which the animals stepped voluntarily.
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Maho Nakazawa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plasma histamine and mMCP-6 levels were measured using a histamine EIA kit (Bertin Bioreagent, Montigny-le-Bretonneux, France) and Mcpt6 ELISA kit (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
André Folgado, Rita Abranches,
bioRxiv - Plant Biology 2021
Quote:
... Protein bands were identified using the Edman reaction and a Procise 491 HT Protein Sequencer to determine the N-terminal sequences (Analytical Laboratory, Analytical Services Unit, ITQB NOVA).
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The hLeptin:hLEP-RCRH2 complex (6 mg/mL) was subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...