-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Liu He, et al.,
bioRxiv - Biochemistry 2022
Quote:
... coli strain BL21 (DE3) with an N-terminal (His)6-SUMO tag from a pE-SUMO-pro expression vector (LifeSensors). Cells were grown in 2YT media at 24°C to an OD600 of 0.8 and then induced with 0.1 mM isopropyl β-D-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Léa Décarie-Spain, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rats expressing inhibitory DREADDs in CA1v-to-LS projections and implanted with an ICV cannula (n=6) were trained to lever press for 45mg sucrose pellets (cat. no. F0023, Bio-Serv) over the course of 6 days with a 1h session each day (2 days of fixed ratio 1 with autoshaping procedure ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed 3 times with Tris Buffered Saline-Tween (TBST) buffer (Boston BioProducts, Cat. # IBB-181–6) and developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
David Scieszka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Each PFC sample (~20 mg, n=6) was homogenized in an Eppendorf tube using a Bullet Blender homogenizer (Next Advance, Averill Park, NY) in 200 μL methanol:PBS (4:1 ...
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... amino acids (5 eq) were activated with N,N′-diisopropylcarbodiimide (DIC, 5 eq, Oakwood Chemical)/Oxyma (5 eq ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Barun Das, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 100 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (AdipoGen Life Science, San Diego, CA) was added to the culture media simultaneously with tamoxifen treatment.
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Manon Gourdelier, et al.,
bioRxiv - Microbiology 2022
Quote:
... Rockland TEBU-BIO);rabbit anti-N 1:3000 (200-401-A50, Rockland TEBU-BIO); mouse anti-S 1:1000 (GTX632604 ...
-
No products found
because this supplier's products are not listed.
Cody Moore, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or recombinant ATF-6 Beta (Abnova H00001388-Q01). Wild-type HEK293T lysate (Origene LY500001 ...
-
No products found
because this supplier's products are not listed.
N Bhaskaran, et al.,
bioRxiv - Immunology 2021
Quote:
... and IL-6 ELISA kits were from Boster Bio (Pleasanton ...
-
No products found
because this supplier's products are not listed.
Martin Minařík, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... or a MicroPublisher 6 color CCD camera (Teledyne Photometrics) controlled by Ocular software (Teledyne Photometrics) ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Amaranta U. Armesto-Jimenez, et al.,
bioRxiv - Genetics 2019
Quote:
To produce lentiviral cell lines containing pGreenFire1™ Pathway Reporter lentivector (Cat#TR010PA-N and Cat#TR000PA-1, System Bioscience) expressing the MUC5B promoter region and controls ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Psilocin (4-hydroxy-N,N-dimethyltryptamine, LGC Standards) was administered by intraperitoneal injection at a dose of 2 mg/kg ...
-
No products found
because this supplier's products are not listed.
Grace I. Borlee, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 100 nM of 2-chloro-adenosine-5’-O-monophsphate (2-Cl-5’-AMP, Axxora, LLC) for internal standardization ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Amy Westerling-Bui, et al.,
bioRxiv - Genomics 2019
Quote:
... synaptopodin (Progen, GP94-N), E-cadherin (R&D ...
-
No products found
because this supplier's products are not listed.
Erika H. Dawson, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... n-tetracosane and n-hexatriacontane at 0.1 µg/mL concentration (both CDN Isotopes), both fully deuterated to enable spectral traceability and separation of internal standards from ant-derived substances ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
YounHa Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
... N-AIMP1 (Atlas Antibodies, Bromma, Sweden), C-AIMP1 (Novus Bio ...
-
No products found
because this supplier's products are not listed.
Sehyun Kim, et al.,
bioRxiv - Genetics 2022
Quote:
... hfRPE cells were treated with 20μM A2E (N-Retinylidene-N-Retinylethanolamine, 20mM stock dissolved in DMSO, Gene and Cell Technologies) for 24 hours.
-
No products found
because this supplier's products are not listed.
Dian Kortleve, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% human serum (Sanquin, Amsterdam, the Netherlands), 200 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Shih-Heng Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... pAAV2/6 (Cell Biolabs Inc., Cat# VPK-426), pAAV2/8 (Cell Biolabs Inc. ...
-
No products found
because this supplier's products are not listed.
Miles H. Black, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 50 μM 6-biotin-17-NAD+ (Trevigen). Reactions were incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Lea, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Vitrified blastocysts (day 5 and day 6) were thawed using the vitrification thaw kit (Irvine Scientific; 90137-SO) following the manufacturer’s instructions ...