-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
Kaitao Li, et al.,
bioRxiv - Immunology 2023
Quote:
... the silanized coverslips were incubated with 1% w/v lipoic acid polyethylene glycol-succinimidyl ester (Biochempeg: HE039023-3.4K, MW 3400) and 10% w/v monofunctional polyethylene glycol-succinimidyl ester (Biochempeg ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Ons M’Saad, Joerg Bewersdorf,
bioRxiv - Cell Biology 2020
Quote:
... or 200 μM NHS ester-DY634 (Dyomics, catalog no. 634-01A), dissolved in 100 mM sodium bicarbonate (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Xin Sun, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Carboxyfluorescein succinimidyl ester (CFSE) was purchased from Tonbo Biosciences (San Diego, CA). All other chemicals were purchased from ThermoFisher (Waltham ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Adrienne R. Guarnieri, et al.,
bioRxiv - Physiology 2021
Quote:
... IL-6 (Bioss BSKM1004) and TNF-α (Bioss BSKM1002 ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and everolimus (Targetmol, 159351-69-6). The cells were then incubated for 72 hrs ...
-
No products found
because this supplier's products are not listed.
Ellen Busschers, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ascorbic acid free α-MEM (Caisson laboratories) supplemented with 10% FBS (Gibco) ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Dian Kortleve, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% human serum (Sanquin, Amsterdam, the Netherlands), 200 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Megan R. Sayyad, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and non-essential amino acids (0.02mM, Gemini Bio-Products). The mouse mammary carcinoma cell line 4T1 (gift from Dr ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... DMA (Dimethylarsinic Acid Standard Solution, LGC Standards; NIST-3031) and MMA (Monomethylarsonic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Jennifer V. Gerbracht, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-CASC3 amino acid residues 367-470 (Atlas Antibodies, #HPA024592), anti-EIF4A3 (Genscript) ...
-
No products found
because this supplier's products are not listed.
Wisath Sae-Lee, et al.,
bioRxiv - Systems Biology 2021
Quote:
... For ghosts dissolved in Diisobutylene/Maleic Acid (DIBMA, Cube Biotech) (Oluwole et al. ...
-
No products found
because this supplier's products are not listed.
Clinton Cheney, et al.,
bioRxiv - Microbiology 2024
Quote:
... with RedSafe Nucleic Acid Staining Solution (Bulldog Bio, Portsmouth, NH) and electrophoresis settings of 85 V for 45 minutes.
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Kevin S. Cannon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lipidated YxxΦ-cargo peptide (Oleic acid-S{Lys(FITC))}KVTRRPKASDYQRL) was synthesized by Biomatik. HRV3C protease ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Immunology 2019
Quote:
... total RNA was isolated from ethylenediaminetetraacetic acid (EDTA)-collected plasma using Total RNA Purification Kits (Norgen Biotek). Small RNA (cDNA ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.