-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Jack F. Webster, et al.,
bioRxiv - Neuroscience 2019
Quote:
... unfixed C57BL/6 mouse brains (N = 3) were embedded in tissue freezing medium (Leica Biosystems, Richmond, UK), frozen on a dry ice ethanol bath ...
-
No products found
because this supplier's products are not listed.
Danny Galleguillos, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-[(1R,2R)-1-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl)-1-hydroxy-3- (pyrrolidin-1-yl)propan 2-yl] nonanamide (GENZ-123346) was obtained from Toronto Research Chemicals (TRC G363450) and solubilized in DMSO ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Andrew Pountain, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
No products found
because this supplier's products are not listed.
Camilla Ugolini, et al.,
bioRxiv - Genomics 2021
Quote:
... 0.5 mM 3′-azido-ddGTP (Trilink, #N-4008), 0.2 mM S-adenosylmethionine (SAM ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
A.R. von Gundlach, et al.,
bioRxiv - Biophysics 2019
Quote:
... after in situ activation with four equivalents of N,N,N′,N′-Tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU; Carbosynth, Berkshire, United Kingdom) and eight equivalents of N-Methylmorpholine (NMM ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Matthew Denholtz, et al.,
bioRxiv - Genomics 2019
Quote:
... cells were washed 3×3 minute in PBS and fixed for 30 minutes in 6% paraformaldehyde (Electron Microscopy Sciences 15710) in 1x PBS ...
-
Sodium 2-(1H-indol-3-yl)acetate (3-Indoleacetic acid sodium, Indole-3-acetic acid sodium, 3-IAA...
Cat# S3324, SKU# S3324-25mg,
25mg, $99.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34; A41159, ApexBio) N-(p-amylcinnamoyl ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
Chromatographically purified through step five of the procedure of Yamada and Yasunobu, J. Biol....
Cat# LS003114,
3 ku, $425.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Rachel L. Edwards, et al.,
bioRxiv - Microbiology 2019
Quote:
... Luna-NH2 column (3 μm, 150 × 2 mm, Phenomenex) was used flowing at 0.4 mL/min ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Yuran Zhu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2) 4.17 mM GadoSpin-P (n=6; MW=200 kDa; Miltenyi Biotec, Bergisch Gladbach, Germany); and 3 ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Qiong J Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The cell viability was documented via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Biotium, Fremont, CA).
-
No products found
because this supplier's products are not listed.
Yali Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Khyati Gohil, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The images of these droplets (n ≥ 3) were acquired with Metamorph software (Molecular Devices) with a 30-s interval and a 100-ms exposure time.
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Shuoguo Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... a high-NA dry objective lens (LMRlanFL N 100X, NA/WD: 0.8/3 mm, Olympus, Japan) was placed underneath the vitrified specimen ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Tulsi Upadhyay, Vaibhav V Karekar, Ishu Saraogi,
bioRxiv - Biochemistry 2020
Quote:
... All GrpE variants were labeled with DACM (N-(7-dimethylamino-4-methylcoumarin-3-yl)maleimide) (AnaSpec) and DnaK was labeled with BODIPY-fluorescein-N-(2-aminoethyl)-maleimide (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biophysics 2023
Quote:
... the cells were stained with 200 μL of 5 mg/mL solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stain (Research Products International) in PBS ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Rachel E. Young, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cells were assayed using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium reduction assay (BioVision, Milpitas, CA) according to manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences were used for probe visualization.
-
6 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P06-1.5H-N,
20/case, $249.00
Ask
R. A. Petazzi, et al.,
bioRxiv - Biophysics 2020
Quote:
... 3-6 · 105 cells were plated onto 35 mm glass-bottom dishes (CellVis, Mountain View ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Vivek Jani, et al.,
bioRxiv - Biophysics 2023
Quote:
... incubated for 1 minute in rigor buffer with the fluorescent ATP analog 25 μM 2’-/3’-O-(N’-Methylanthraniloyl) adenosine-5’-O-triphosphate (a.k.a. mant-ATP, Enzo Life Sciences, Axxora LLC, Framingham, NY), and moved to room temperature relaxing buffer ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Anne Charlotte le Floch, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were cultured O/N or 1h for SUP-T1 on dishes (Ibidi, Cat.No: 80136) precoated with poly-L-lysine ...
-
No products found
because this supplier's products are not listed.
Jason Wallach, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...