-
No products found
because this supplier's products are not listed.
Eliot Morrison, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 µl 16 mM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma-Aldrich) prepared in 20% DMSO and 80% t-butanol (Sigma) ...
-
No products found
because this supplier's products are not listed.
Antonia Gurgone, et al.,
bioRxiv - Neuroscience 2022
Quote:
... animals were treated with the selective positive allosteric modulator (PAM) of mGluR5 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB; Tocris, UK) that was diluted in saline solution containing 5-10% final concentration of DMSO and polyethylene glycol 400 (DMSO ...
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Paweł Kozielewicz, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Cyclopamine-KAAD and SANT-1 ((4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine) were from Abcam. All ligands were dissolved in DMSO and stored in aliquots at −20°C ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Ganna Galitska, et al.,
bioRxiv - Microbiology 2023
Quote:
DDD85646/IMP-366(2,6-dichloro-4-[2-(1-piperazinyl)-4-pyridinyl]-N-(1,3,5-trimethyl-1H-pyrazol-4-yl)-benzenesulfonamide) was purchased from Cayman Chemicals and used as an inhibitor of viral assembly at the final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Laura C. Paweletz, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (N-NBD-PE) were purchased from Avanti Polar Lipids Inc ...
-
No products found
because this supplier's products are not listed.
Stefania L. Wunderli, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
No products found
because this supplier's products are not listed.
Milou E. Noltes, et al.,
bioRxiv - Cell Biology 2022
Quote:
Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Mary Lou P. Bailey, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were imaged on agarose pads (see below) containing 100nM 2-[5-(Adamantan-1-yl)-1H-indol-3-yl]acetic acid (“5-IAA”; TCI Product number A3390).
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Stephanie M. Staszko, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male (n=3) and female (n=6) C57BL/6J mice (The Jackson Laboratory) were used for all miniscope experiments ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
Cat# HY-50071-10 mM * 1 mL,
10 mM * 1 mL, USD $77.0
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Anne Billet, et al.,
bioRxiv - Biochemistry 2023
Quote:
... HCTU (O-(1H-6-chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate) from VWR, dichloromethane (DCM) ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Thi Tuyet Trinh Phan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MTT (3-(4,5-dimethylthiazol-2-yl-2, 5-diphenyl tetrazolium bromide)) was purchased from Alfa Aesar (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
No products found
because this supplier's products are not listed.
Anna K.W. Tribe, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5 µg N-3 anti-BCL6 antibody (Santa Cruz, USA) was added to five of the tubes and 5 µg non-specific Invitrogen™ normal rabbit IgG antibody (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Vi Pham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 6 ng/mL interleukin-3 (IL-3) (PeproTech, Rocky Hill, NJ) and 2 uL Lentiblast Premium Transduction Enhancer (OZBiosciences ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Kuan-Ting Huang, et al.,
bioRxiv - Biochemistry 2022
Quote:
Copper Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Cu-TBTA; Lumiprobe, cat. no. 21050)
-
No products found
because this supplier's products are not listed.
Lech Kaczmarczyk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used four individual samples (exceptions: SST RML 10 WPI: n = 3; PV NBH 10 WPI: n = 3; Astro RML 18 WPI: n = 2). RNA was converted to cDNA using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche Aplied Science) ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Golam T. Saffi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
J. Aaron Crapster, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Keiichi Inoue, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 3% n-dodecyl-D-maltoside (DDM, Anatrace, OH) was added and the samples were stirred for overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...