-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or 3 minutes (nateglinide and DCA) prior to addition of 5 µM of the cell-permeable substrate methoxy e-Coelenterazine (Me-O-e-CTZ/Prolume Purple). BRET2 measurements were taken on the BioTek Synergy NEO2 microplate reader.
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Dmt = 2’,6’-dimethylthyrosine) and SS20 (Phe-D-Arg-Phe-Lys-NH2) were obtained from Biomatik (https://www.biomatik.com). SS31 and SS20 were administered intraperitoneally to APP/PS1 Tg and non-transgenic littermate mice (5mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Narendra Kumar, et al.,
bioRxiv - Biophysics 2021
Quote:
... followed by Pt/Ti (20 nm/5 nm) deposition with e-beam (Angstrom Engineering) and lift off using remover PG (MicroChem). To remove photoresist residues and improve the adhesion of electrodes ...
-
No products found
because this supplier's products are not listed.
R. Benjamin Free, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 5,6,7,8-tetrahydro-6-[(2-phenylethyl)propylamino]) derivative labeled with a red fluorescent probe (PPHT-red) was obtained from Cisbio Bioassays (Bagnolssur-Cèze ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Leonardo M. Molina, et al.,
bioRxiv - Biochemistry 2023
Quote:
... or E-cadherin (1:100) (Biorbyt) antibodies ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Lasse Toftdal Dynesen, et al.,
bioRxiv - Microbiology 2023
Quote:
293-F cells were seeded at 2.5 106 cells/mL in FreeStyle 293 Expression medium and transfected by the addition of plasmid DNA (2 µg/mL) and LipoD293 (6 µg/mL #SL100668, Tebu-bio). After 24 h ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
BMMs in 6-well plates (1×106 cells/well) were detached using Accutase® (Innovative Cell Technologies, Inc.) and washed twice with PBS supplemented with 2% FBS ...
-
No products found
because this supplier's products are not listed.
Johanna F. Dekkers, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 μM Y-27632 (Abmole), 5 nM Heregulin β-1 (Peprotech) ...
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
No products found
because this supplier's products are not listed.
Catarina J. Gaspar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were transfected with fluorescent reporter constructs (1 μg total DNA/well, 6 well plate) using GenJet (SignaGen Laboratories) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Silia Ayadi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 6-oxo-cholestan-3β,5α-diol (OCDO; oncosterone) was from Steraloids (Newport, US) and bicalutamide and tamoxifen were from Sigma-Aldrich (Merck KGaA ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL insulin (CELL technologies), 25 ng/mL hydrocortisone (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Shunsuke Kataoka, et al.,
bioRxiv - Immunology 2021
Quote:
... and then pulsed with 2 μg/ml staphylococcal enterotoxin E (SEE) (Toxin Technology #ET404) for 1hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Tyler J. Gibson, Melissa M. Harrison,
bioRxiv - Developmental Biology 2023
Quote:
... a 1:5 dilution of K-MetStat Panel spike-in nucleosomes (EpiCypher, cat. # 19-1002) was added to each reaction prior to addition of antibody ...
-
No products found
because this supplier's products are not listed.
Ronald McGregor, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or rabbit anti-MCH (1:20000, H-070-47, Lot # 01629-5, Phoenix Pharmaceuticals Inc.), followed by the corresponding biotinylated secondary antibody (1:400 ...
-
No products found
because this supplier's products are not listed.
Zahra Mashhadi, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 µg cholera toxin (List Labs; 100B) in PBS ...
-
No products found
because this supplier's products are not listed.
Kirsi Savijoki, et al.,
bioRxiv - Microbiology 2021
Quote:
... Rifampicin solution (TOKU-E) in water at a final concentration of 400 µg mL-1 corresponding to 64 x MIC (minimum inhibitory concentration ...
-
No products found
because this supplier's products are not listed.
LP Legakis, L Karim-Nejad, SS Negus,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Ketoprofen (Spectrum Chemical, New Brunswick, NJ, 5 mg/kg) was administered immediately and 24 hours after surgery as a postoperative analgesic ...
-
No products found
because this supplier's products are not listed.
Bharti Bhatia, et al.,
bioRxiv - Microbiology 2021
Quote:
... and a FluorChem E system (Protein simple).