-
No products found
because this supplier's products are not listed.
Wenhui Zheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride (A3281, Sigma, MO, USA); 500nM ZSTK474 (S1072 ...
-
No products found
because this supplier's products are not listed.
Sarah Easson, et al.,
bioRxiv - Physiology 2022
Quote:
... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Jessica L Hoffman, et al.,
bioRxiv - Neuroscience 2022
Quote:
5-[2-Chloro-6-(trifluoromethoxy)phenyl]-1,3-dihydro-2H-benzimidazol-2-one (JNJ-5; Tocris, Minneapolis, MN) is a high affinity ...
-
No products found
because this supplier's products are not listed.
Mahebali Tabusi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
No products found
because this supplier's products are not listed.
Bar Manori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
No products found
because this supplier's products are not listed.
Etienne Baratchart, et al.,
bioRxiv - Immunology 2021
Quote:
... Male C57BL/6 mice (5-6 weeks old) were purchased from Jackson Laboratory. Mice (n=30 ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Thomas J. Kucharski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Nuf2 (Santa Cruz E-6; IB at 1:1000), phospho-Hec1 Ser44 (gift of Jennifer DeLuca ...
-
No products found
because this supplier's products are not listed.
Alexey A. Gavrilov, et al.,
bioRxiv - Genomics 2019
Quote:
... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
Xin Zhou, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5-6 weeks old ICR mice (Envigo) were infected with 2×105 C ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Stamatis Papathanasiou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
No products found
because this supplier's products are not listed.
Axel Guilbaud, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5’-Ethynyl-2’-deoxycytidine and 5’-chloro-2’- deoxycytidine were obtained from Cayman Chemical Company (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Tomas Kouba, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For labeling pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl)phosphate (Jena bioscience), was ligated to the 3’ end of the 16 nt RNA using T4 RNA ligase (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Gracia Bonilla, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5 ng/ml rmIL-6 (all from Peprotech). Progenitors were transferred to RetroNectin®-coated (Lonza ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Sören Kuypers, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 5% (V/V) FCS (LO CC-3202/6, Lonza) up to 70-75% confluency ...
-
No products found
because this supplier's products are not listed.
Stefano Suzzi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4’,6-diamidino-2-phenylindole (1:10,000; Biolegend) was used.
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Michele LeRoux, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Arens Taga, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and passaged once every 5-6 days using Dispase (StemCell Technology). To maintain pluripotency and limit spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Callum Beach, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and (6) E-cadherin (1:500, 3195; Cell Signaling)–Opal 690.
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Richard D. Lutze, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% Tween 80 (9005-65-6, MP Biomedicals), 40% PEG 300 (192220010 ...
-
No products found
because this supplier's products are not listed.
Kai Dünser, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
No products found
because this supplier's products are not listed.
M.V. Dziuba, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3D-SIM (striped illumination at 3 angles and 5 phases) was performed on an Eclipse Ti2-E N-SIM E fluorescence microscope (Nikon) equipped with a CFI SR Apo TIRF AC 100×H NA1.49 Oil objective lens ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Valentin Joste, et al.,
bioRxiv - Microbiology 2023
Quote:
Forward primers were marked in 5’ with 6-FAM or HEX fluorophores (Eurogentec®) and when useful ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
Cat# HY-15941-10 mM * 1 mL,
10 mM * 1 mL, USD $74.0
Ask
LeYuan Gu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or β receptor antagonist propranolol (2·5 mg/mL, 5 mg/mL, n = 6, HY-B0573, MedChemExpress) or vehicle was administered via the lateral ventricle catheter ...
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
No products found
because this supplier's products are not listed.
Igor L. Bado, et al.,
bioRxiv - Cancer Biology 2020
Quote:
5×105 cells were plated in low attachment 6 well plates (Greiner) using regular (10% FBS ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5(6)-CTAMRA (Carbosynth/Novabiochem); TFA (Alfa Aesar) ...
-
No products found
because this supplier's products are not listed.
Sergii Palchevskyi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 5-6 mM LMNG (Anatrace) and 1-1.2 mM Cholesteryl Hemisuccinate Tris Salt (CHS ...