-
No products found
because this supplier's products are not listed.
Stephen B. McHugh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were then incubated with primary antibodies diluted in 3% NDS blocking solution and incubated at 4 °C for 72 hours (GFP anti-chicken, 1:1,000, Aves Labs, catalog no ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Kailash Venkatraman, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were back-diluted 1:100 in fresh CSM containing 2% glucose or 3% glycerol and shaken in a plate reader (Tecan) for 48 hours ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μl Detection Buffer 1 (CisBio) was immediately added to the reaction mixture ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Jasmine M Manouchehri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The concentrations of sulfatase 1 and 2 (Lifespan Biosciences, Cat# LS-F66757-1 and LS-F35926-1) were measured in the supernatants of the examined cell lines at basal level via enzyme-linked immunoassay (ELISA ...
-
No products found
because this supplier's products are not listed.
Cambrian Y. Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 2 μM Cy3 azide (Click Chemistry Tools AZ119-1), and 100 mM ascorbic acid freshly prepared and diluted in Gomori buffer (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
LC Laboratories' Product Number R-1234 - Roscovitine, Free Base (Seliciclib, CYC202,...
Cat# R-1234, SKU# R-1234_10mg,
10 mg, $49.00
Ask
Kai Otsuka, et al.,
bioRxiv - Genomics 2023
Quote:
... containing 2i (1 μM PD0325901, LC Laboratories, MA; and 3 μM CHIR99021, LC Laboratories) and LIF (1,300 U /ml ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Dony Maiguel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... [1-14C]oleic acid (C18:1) and [1-14C]linoleic acid (C18:2) were obtained from American Radiolabeled Chemicals (St. Louis, MO). [1-14C]stearic acid was obtained from Amersham Biosciences ...
-
No products found
because this supplier's products are not listed.
Emily Lerner, et al.,
bioRxiv - Immunology 2023
Quote:
OT-1 T-cells were isolated from OT-1 mice by culturing OT-1 splenocytes in T-cell media supplemented with 50IU/mL IL-2 and 1 μM OVA SIINFEKL peptide (Anaspec) for 48 h ...
-
No products found
because this supplier's products are not listed.
Michael D. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... or entire S2 domain of SARS-CoV-2 Wuhan-Hu-1 S (ACROBiosystems). Beads were resuspended in PBS + 0.05% BSA ...
-
No products found
because this supplier's products are not listed.
Yoann G. Santin, et al.,
bioRxiv - Microbiology 2023
Quote:
... manually back blotted for 3-4 secondes and flash-frozen in liquid ethane using a CP-3 plunger (Gatan). Data were collected on a 300-kV CRYO ARM™ 300 (JEM-Z300FSC ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-hydroxy-1-naphthaldehyde (Ark Pharm); and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Aude Noiret, Fabienne Aujard, Jeremy Terrien,
bioRxiv - Evolutionary Biology 2023
Quote:
... ref MS E-5100) and 8-hydroxy-2’-deoxyguanosine (“8-OHdG,” in ng.ml− 1; OxiSelectTM Oxidative DNA Damage Elisa kit, Cell Biolabs Inc., ref STA-320) were measured in duplicates from urine samples as indicators of the organisms’ response to environmental stress (Miller et al. ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... and SARS-CoV-2 E (MyBioSource, MBS9141944) for 4 hrs.
-
No products found
because this supplier's products are not listed.
Marta Varela-Eirín, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1 ng/ml recombinant human fibroblast growth factor-2 (rhFGF-2; Immunotools) or in MesenPRO RS™ Medium supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin.
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Franziska Eck, Manuel Kaulich, Christian Behrends,
bioRxiv - Cell Biology 2020
Quote:
... Bafilomycin A1 (Biomol, Cay11038-1, 200 nM in DMSO, 2 hrs), Torin 1 (Tocris ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...