-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Tae-Wuk Kim, et al.,
bioRxiv - Plant Biology 2019
Quote:
... or 15N MS medium (1/2 MS without nitrogen source [PhytoTechnology Laboratories] ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Amy Cheung, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% Bovine Serum Albumin in TBST for 2 hours (mouse anti-SERT 1:7000, MAb Technologies, ST51-2 ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Sanghwa Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and then immunoblotted using anti-HY5 (Abiocode, Cat. R1245-2, dilution 1:3000), anti-NRT1.1 (Agrisera ...
-
No products found
because this supplier's products are not listed.
Shunsuke Kataoka, et al.,
bioRxiv - Immunology 2021
Quote:
... and then pulsed with 2 μg/ml staphylococcal enterotoxin E (SEE) (Toxin Technology #ET404) for 1hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Malika Aid, et al.,
bioRxiv - Microbiology 2021
Quote:
... at 1:1000 detection using Mouse Polink-2 HRP (GBI Labs Cat. No. D37-110). Staining for MPO and Mx1 IHC was performed as previously described using a Biocare intelliPATH autostainer ...
-
Cat# G209,
USD $10.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Azido-dPEG12-TFP ester (1 mg, Quanta BioDesign, USA) in DMSO for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Scott P. Souza, et al.,
bioRxiv - Immunology 2021
Quote:
... and blocked with coating buffer containing with 1% BSA (w/v) and 2% goat serum (Omega Scientific) in PBS ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Jitendra S. Kanshana, et al.,
bioRxiv - Genetics 2021
Quote:
... non-esterified fatty acids or NEFAs (HR series NEFA-HR[2] Reagents; Wako Diagnostics), leptin (mouse leptin ELISA ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Frauke Muecksch, et al.,
bioRxiv - Immunology 2022
Quote:
Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Lindsey N. Block, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 2% FBS (Peak Serum, Wellington ...
-
No products found
because this supplier's products are not listed.
Pascale Lemieux, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and 2% DMSO (Bioshop Canada)) to an OD of 0.1 ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Svetlana Glushakova, et al.,
bioRxiv - Biophysics 2022
Quote:
... The mechanical activation of PIEZO1 in RBC by shear stress was achieved by constant agitation of cells (1-2 × 108 cells/ml) on the platform of a “Belly Button Shaker” (Model BBUAAUV15, Ibi Scientific) at a speed of 14 rpm ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
Native Antigen
Cat# NAT41589-100,
100µg USD $426.0
Ask
Guillermo León, et al.,
bioRxiv - Microbiology 2020
Quote:
... and SARS-CoV-2 Spike E-M mosaic protein (code REC31829) were purchased from The Native Antigen Company (Oxford, United Kingdom). SARS-CoV-2 Spike RBD Protein (Cat ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Natalia Gebara, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 2% Chang Medium C (Irvine Scientific), 20% Fetal Calf Serum (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jagannath Maharana, et al.,
bioRxiv - Biochemistry 2022
Quote:
Quantifoil holey carbon grids (Cu or Au, R2/1 or R2/2) were glow discharged for 45 s with a Glocube (Quorum technologies Ltd, UK). 3 μl of the complex was dispensed on the glow discharged grid ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Camilla Margaroli, et al.,
bioRxiv - Pathology 2022
Quote:
... Anti-SARS-CoV-2 was conjugated to PE / R-Phycoerythrin (Expedeon Lightning-Link R-PE Conjugation Kit / Abcam ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Anna A. Kiseleva, et al.,
bioRxiv - Cell Biology 2022
Quote:
... All cultured cell lines were routinely tested for mycoplasma contamination every 3 months using a e-Myco VALID Mycoplasma PCR Detection Kit (iNtRON Biotechnology, Inc., cat# 25239).
-
No products found
because this supplier's products are not listed.
Aaron J Farrugia, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Reverse transcription was performed using Precision NanoScript 2 Reverse-Transcription-kit (PrimerDesign) and qPCR using PrecisionPLUS 2x qPCR MasterMix with ROX and SybrGreen (PrimerDesign) ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...