-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
6 micro-well glass bottom plate with #1 cover glass(0.13-0.16mm), micro-well size 14mm, with...
Cat# P06-14-1-N,
20/case, $178.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Laura Di Patria, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MMP2 activity was evaluated by a colorimetric assay using Ac-Pro-Leu-Gly-[2-mercapto-4-methyl-pentanoyl]-Leu-Gly-OC2H5 thiopeptide (50 µM; BioMol International, Hamburg, Germany) in 50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μl Detection Buffer 1 (CisBio) was immediately added to the reaction mixture ...
-
No products found
because this supplier's products are not listed.
Marta Varela-Eirín, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1 ng/ml recombinant human fibroblast growth factor-2 (rhFGF-2; Immunotools) or in MesenPRO RS™ Medium supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin.
-
No products found
because this supplier's products are not listed.
Huntly M. Morrison, et al.,
bioRxiv - Immunology 2022
Quote:
... Sections were stained with 0.3% uranyl acetate/2% methyl cellulose and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA) equipped with an AMT 8 megapixel digital camera and AMT Image Capture Engine V602 software (Advanced Microscopy Techniques) ...
-
No products found
because this supplier's products are not listed.
Kevin R. Trabbic, et al.,
bioRxiv - Immunology 2021
Quote:
β-1,3(1-6) glucan (Yeast Beta Glucan, Megazyme, Bray, Ireland; 3 mg) was suspended in 4.9 mL MilliQ H2O contaning 100 μL of 1 M NaOH ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
No products found
because this supplier's products are not listed.
Marta Vranas, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or mouse anti-mitofusin 2 (1:50, mAb 661-757, Abnova) was added for overnight incubation at 4 °C ...
-
No products found
because this supplier's products are not listed.
Michael D. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... or entire S2 domain of SARS-CoV-2 Wuhan-Hu-1 S (ACROBiosystems). Beads were resuspended in PBS + 0.05% BSA ...
-
No products found
because this supplier's products are not listed.
Emily Lerner, et al.,
bioRxiv - Immunology 2023
Quote:
OT-1 T-cells were isolated from OT-1 mice by culturing OT-1 splenocytes in T-cell media supplemented with 50IU/mL IL-2 and 1 μM OVA SIINFEKL peptide (Anaspec) for 48 h ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were blocked for 2 h at 4°C with 5% normal goat serum in PBST and incubated with anti-EGFP (1:2000, Aves Labs, GFP-1010), anti-HA (1:500 ...
-
No products found
because this supplier's products are not listed.
Ming Zhou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech), Nε-Boc-L-lysine (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Aude Noiret, Fabienne Aujard, Jeremy Terrien,
bioRxiv - Evolutionary Biology 2023
Quote:
... ref MS E-5100) and 8-hydroxy-2’-deoxyguanosine (“8-OHdG,” in ng.ml− 1; OxiSelectTM Oxidative DNA Damage Elisa kit, Cell Biolabs Inc., ref STA-320) were measured in duplicates from urine samples as indicators of the organisms’ response to environmental stress (Miller et al. ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Stephen J. DeCamp, et al.,
bioRxiv - Biophysics 2020
Quote:
Polymerized polyacrylamide gels were first treated with 440 μL of a 1:50 (v/v) mixture of Sulfosuccinimidyl 6-(4'-azido-2'-nitrophenylamino)hexanoate (Sulfo-SANPAH) (ProteoChem) and 50 mM HEPES solution under a UV light for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... and SARS-CoV-2 E (MyBioSource, MBS9141944) for 4 hrs.
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Jasmine M Manouchehri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The concentrations of sulfatase 1 and 2 (Lifespan Biosciences, Cat# LS-F66757-1 and LS-F35926-1) were measured in the supernatants of the examined cell lines at basal level via enzyme-linked immunoassay (ELISA ...
-
No products found
because this supplier's products are not listed.
John C. Ahn, Scott M. Coyle,
bioRxiv - Systems Biology 2023
Quote:
... 0.1 mg ml-1 PLL(20)-g[3.5]-PEG(2) (SuSoS CHF9,600.00) solution was added for 1 hour ...
-
No products found
because this supplier's products are not listed.
J. Z. Alex Cheong, et al.,
bioRxiv - Microbiology 2021
Quote:
... with 0.2 g of 1 mm sterile glass beads for 10 min at full-speed on a Vortex-Genie 2 (Scientific Industries, Bohemia, NY) before serial dilution and spot plating 20 μL on TSA plates with no antibiotic supplementation.
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Jason I. Griffiths, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Tissue was homogenized by mincing with a sterile razor blade in 2 mL of sterile 4:1 Lysis Buffer (10mM Tris-HCl, pH 7.8 (Teknova, Cat# T1078), 146mM NaCl (Alfa Aesar ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Jan Becker, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silicon gasket (Grace Bio-Labs CultureWell, 3 × 1 mm; U.S.) was laid on the coverslip to contain the sample ...
-
No products found
because this supplier's products are not listed.
Nanami Kikuchi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and 2 µl of 1% w/v amine polystyrene fluorescent yellow particles (NH2-beads, Spherotech, Inc) or carboxyl polystyrene fluorescent yellow particles (Spherotech ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Brianna M. Doratt, et al.,
bioRxiv - Immunology 2023
Quote:
Freshly thawed UCBMCs (1-2×106 cells) were stained with Ghost Violet 540 (Tonbo Biosciences, San Diego, CA) for 30 min at 4C in the dark before being incubated with Fc blocker (Human TruStain FcX ...
-
No products found
because this supplier's products are not listed.
Caro-Astorga Joaquin, et al.,
bioRxiv - Microbiology 2019
Quote:
... reduced with 2 μL of 50 mM Tris(2-carboxyethyl) phosphine (TCEP, SCIEX), pH 8.0 ...
-
No products found
because this supplier's products are not listed.
H E Foster, C Ventura Santos, A P Carter,
bioRxiv - Cell Biology 2021
Quote:
... a movie containing 10 frames during exposure of 2 e-/Å2 was acquired on a K2 camera (Gatan). Dataset 1 was acquired on GFP-RFP-LC3 neurons at DIV 4 on MRC-LMB Krios 3 at nominal pixel size 3.44 Å/pix using a zero-centered tilt scheme from -30° to +60° then -30° to -30° (30/32 tomograms acquired were reconstructed) ...