-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Giuseppe Gangarossa, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ...
-
No products found
because this supplier's products are not listed.
H. Hendrix, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joseph O. Magliozzi, James B. Moseley,
bioRxiv - Cell Biology 2021
Quote:
... all strains were grown in YE4S at 32°C and treated with 30 μM 3-Brb-PP1 (3-[(3-Bromophenyl)methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (Abcam) for 1 h and fixed in ice-cold 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Marijn de Boer, et al.,
bioRxiv - Biophysics 2019
Quote:
... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Juan Martín D’Ambrosio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 18:1 lyso-PS (1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine, Avanti Polar Lipids), was dried under argon and resuspended in SD medium to 54 μM lyso-PS by vortexing and heating to 37°C ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Masaki Tsuchiya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... [2-[(Methylthio)(2H-pyrrol-2-ylidene)methyl]-1H-pyrrole](difluoroborane) (TCI, M2609) was reacted with dibenzocyclooctyne-amine (TCI ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Stefano Suzzi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4’,6-diamidino-2-phenylindole (1:10,000; Biolegend) was used.
-
No products found
because this supplier's products are not listed.
Chrysa Kapeni, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
Cat# HY-N4226-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Wenmeng Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... JQ-1 carboxylic acid (MedChemExpress, cat#202592-23-2); 1,6-hexanediol (Aladdin ...
-
No products found
because this supplier's products are not listed.
Stamatis Papathanasiou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Shunya Kaneko, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
G. Siano, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Eduard Fadeev, et al.,
bioRxiv - Microbiology 2023
Quote:
... and stained with 2 µg mL-1 4′,6-diamidino-2-phenylindole (DAPI) in Vectashield (Vector Laboratories, Newark, CA, USA). The cells were enumerated using a Zeiss Axio Imager M2 epifluorescence microscope (Carl Zeiss AG ...
-
No products found
because this supplier's products are not listed.
Apurva A. Govande, et al.,
bioRxiv - Microbiology 2023
Quote:
... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Genetics 2020
Quote:
4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Julia K. Rotow, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and maintained in culture for a total of approximately 2-3 months in DMEM supplemented with 1 ng/mL IL-3 (Peprotech). Mycoplasma testing was not performed ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Theresa K Leslie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then were incubated for 10 minutes at 21 °C in 1 μM 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Biotium) in PSS ...
-
No products found
because this supplier's products are not listed.
M. Dolores Martin-de-Saavedra, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ...
-
No products found
because this supplier's products are not listed.
Sandeep Ameta, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... 4-(2-Hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS) was purchased from Alfa Aesar (Product no. ...
-
No products found
because this supplier's products are not listed.
Amy Krans, et al.,
bioRxiv - Neuroscience 2019
Quote:
... ubiquilin 2 (Novus Biologicals, 1:200, acid AR), NTF1 (Abclonal ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... Antihuman ACE-2 (R&D Systems, USA, 1:50, 2h at 37°C) was used for identification of ACE-2 ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Sladjana Skopelja-Gardner, et al.,
bioRxiv - Immunology 2020
Quote:
... Initial experiments were conducted using both male and female C57BL/6J mice (Jackson Labs, 3-4 months old, Figs. 1-2). Female mice were used for all subsequent experiments ...