-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Olga Yu. Shagaleeva, et al.,
bioRxiv - Microbiology 2024
Quote:
... USA). O-methyl hydroxylamine hydrochloride (purity: 98.0%; lot no. 542171) was purchased from J&K Scientific Ltd ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 4 µg Cx36-SNAP and 4 µg V5-dGBP-TurboID using 50 µl Geneporter2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Stephanie Saundh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4) 6X-HisGSK3β purchased from Signalchem (G09-10H-05) for BLI and MST experiments ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The cells were exposed to 6 Gy radiation from the X-ray tube (Rad Source Technologies, USA) at a fixed dose rate of 1.15 Gy/min.
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Emily S. Bellis, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Czech Republic; CAS: 151716-18-6) or (±)orobanchol (Olchemim; CAS: 220493-64-1) at 0.01 µM and (±)-GR24 (Chempep, Wellington ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... The plate was left to incubate for 6 hours followed by addition of the ESF-AF medium (Expression systems). Sf9 cells were left for seven days at 27 °C without agitation ...
-
No products found
because this supplier's products are not listed.
Jiang-An Yin, et al.,
bioRxiv - Genomics 2023
Quote:
... Viral titers of the sgRNA libraries were determined by a 6-point dose response in 6-well plates by puromycin selection and determination of live and dead cells (T.spiezzo, Cellecta) or flow cytometry of RFP+ cells (Brunello ...
-
No products found
because this supplier's products are not listed.
Cerys S Manning, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Western blots were performed using 4-20% Tris-glycine acrylamide gels (NuSep), Whatman Protran nitrocellulose membrane (Sigma ...
-
No products found
because this supplier's products are not listed.
Jugal Kishore Das, et al.,
bioRxiv - Immunology 2022
Quote:
... male C57BL/6 mice were injected with an emulsion of 100 µl of chick type II collagen (Chondrex; 100 µg) in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Maciej M. Jankowski, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the outer panels of every third section contain two nose-poke ports (Fig 2; a total of 12 ports in 6 sections, SPECIAL.090-SE v1.0, LaFayette-Campden Instruments, Loughborough, UK). One of the two ports in each section is connected to a liquid pump and the other to a pellet dispenser ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Desirée Böck, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Brain sections were incubated with primary antibodies overnight at 4°C (rabbit-NeuN, 1:1’000, abcam 177487; mouse-TH; 1:1’000, Immunostar 22941 ...