-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Felix Michaud, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 10kHz; Digidata 1440, Molecular Devices, CA, USA) was performed using the Multiclamp 700B amplifier and the Clampex 10.9 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Jiali Yu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 500 μM indole-3-acetic acid (IAA, chemical analog of auxin, C3290, APExBIO) was used to induce CTCF degradation.
-
No products found
because this supplier's products are not listed.
Xiao-Wei Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... or pretreated with 75 μM indole-3-acetic acid (IAA, Solarbio, Beijing, China), 50 μM 1-naphthylphthalamic acid (NPA ...
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
No products found
because this supplier's products are not listed.
Lucas Tricoli, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Alcian blue solution was prepared using 3% glacial acetic acid (Amresco, 0714-500) and Alcian blue 8GX (Sigma ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
3-chloro-5-hydroxybenzoic Acid is a selective agonist of the lactate receptor GPR81.
Cat# S5400, SKU# S5400-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Kevin M. Cury, Richard Axel,
bioRxiv - Neuroscience 2021
Quote:
... 40 ml of substrates containing agarose and 3% acetic acid was poured into the lid or base of a 120 mm square petri dish (Greiner) and allowed to set for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Eden L. Sikorski, et al.,
bioRxiv - Immunology 2021
Quote:
... The free amine of the lysine side chain was coupled to 3-maleimidopropionic acid (2 equivalents, Chem-Impex #14709) using HBTU and DIEA for 2 hours at room temperature (Scheme S1) ...
-
No products found
because this supplier's products are not listed.
Rebecca T. Perelman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
No products found
because this supplier's products are not listed.
Ziad Jowhar, et al.,
bioRxiv - Genomics 2023
Quote:
... the media was changed and fresh media with 500 μM IAA (Indole- 3-acetic acid, the most common naturally occurring Auxin hormone) (Research Products International, cat: I54000-5.0) or DMSO was added to cells ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kerri L. Miazgowicz, et al.,
bioRxiv - Microbiology 2022
Quote:
... Transfected cells were rapidly cooled and stained in blocking solution (dPBS with 2% (v/v) bovine serum albumin (BSA)) containing anti-MXRA8 (1:100, W040-3, MBL International), anti-hTIM1(1:100 ...