1 - 50 of 631
suppliers found for
6 Chloro 3 imino 2 3 dihydropyridazine 2 acetic acid
» view 10000+ matched products-
Alfa Chemistry Sponsored
Cat# ACM127566181, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Physiology 2022Quote: ... 3 mM 2-Imino-1-imidazolidineacetic acid (cyclocreatine, Sigma-Aldrich), 50 µM NG,NG-Dimethylarginine dihydrochloride (ADMA ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Genetics 2018, published in Cell doi: 10.1016/j.cell.2018.02.002Quote: ... 100 mM indole-3-acetic acid (IAA; Alfa Aesar, 10171307) was prepared in ethanol and stored for up to one month at 4°C ... -
Tocris
No products found because this supplier's products are not listed.Cited in TRPM4 is required for calcium oscillations downstream from the stretch-activated TRPV4 channelbioRxiv - Cell Biology 2021Quote: ... CBA (4-chloro-2-[[2-(2-chlorophenoxy) acetyl aminobenzoic acid from Tocris Bioscience (Minneapolis ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... gasderminC-2/-3 (Rabbit monoclonal; 229896; Lot# GR3317481-6; abcam), gasdermin D (Rabbit polyclonal ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Indole-3-acetic acid sodium (IAA, Santa Cruz, sc-215171, 500 µM); Human fibronectin (Roche Diagnostics ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in Influenza A matrix protein M1 induces lipid membrane deformation via protein multimerizationbioRxiv - Biophysics 2019, published in Bioscience Reports doi: 10.1042/BSR20191024Quote: ... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding. -
VWR
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... 4 ml of pre-chilled (−20°C) methanol/acetic acid (3:1, VWR chemicals) was added dropwise and flicking to homogenize ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ... -
Addgene
No products found because this supplier's products are not listed.Cited in USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STINGbioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ... -
Gold Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... and fixed by placing them in 2% acetic acid in small Petri dishes (Corning) for 30 minutes at room temperature ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... IL-3 and IL-6 (PeproTech 300-07 ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem. -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 2-chloro-1,4-naphthoquinone was purchased from TCI America ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Zoology 2020, published in Biomolecules doi: 10.3390/biom10070978Quote: ... The protein pellet was redissolved in 260 μl lysis buffer (6 M urea, 2 M thiourea, 4% CHAPS, 30 mM DTT, and GE Healthcare 2% IPG buffer pH 3–10). GE Healthcare IEF strips (pH 3–10NL ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Frontiers in Neuroscience doi: 10.3389/fnins.2019.00201Quote: ... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Digested cells were washed three times with PBS and resuspended in 2/3 Cultrex Type 2 (R&D Systems) and 1/3 Full Lung Ad-DF+++ medium and plated in drops which were allowed to solidify for 30 minutes at 37°C after which they were overlayed with Full Ad-DF+++ medium ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
Worthington Biochemical
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...Cat# LS004183, 5 gm, $825.0 AskbioRxiv - Developmental Biology 2019, published in Journal of the American Society of Nephrology doi: 10.1681/ASN.2020010052Quote: ... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... A long tempered small tip (2 — 3 μm in diameter) patch pipette (∼3 MΩ; borosilicate glass, WPI, GBF 150-86-10) was used to pressure inject the dye into the extracellular space at 4 — 6 psi for 14 minutes ... -
MedChemExpress
Cat# HY-W015061-10 mM * 1 mL, 10 mM * 1 mL, USD $55.0 AskbioRxiv - Immunology 2020Quote: ... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Methods doi: 10.1038/s41592-019-0581-xQuote: ... Wide-field images (Fig.1, 2, 3, 5, 6) were acquired with a 4× objective (Olympus XLFluor 4x/340a); high-resolution images (Fig ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Communications doi: 10.1038/s41467-018-07162-5Quote: ... Data acquisition (filtered at 2-3 kHz and digitized at 10kHz; Digidata 1440, Molecular Devices, CA, USA) was performed using the Multiclamp 700B amplifier and the Clampex 10.5 software (Molecular Devices) ...