-
No products found
because this supplier's products are not listed.
Pedro Gonzalez-Menendez, et al.,
bioRxiv - Physiology 2022
Quote:
... 3 mM 2-Imino-1-imidazolidineacetic acid (cyclocreatine, Sigma-Aldrich), 50 µM NG,NG-Dimethylarginine dihydrochloride (ADMA ...
-
No products found
because this supplier's products are not listed.
Braveen B. Joseph, et al.,
bioRxiv - Genetics 2021
Quote:
Auxin (indole-3-acetic acid) was purchased from Alfa Aesar. A 100× stock auxin solution (0.4 M ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Francis M. Kobia, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
M. Inês Pascoal Ramos, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Ismail Dahmani, Kai Ludwig, Salvatore Chiantia,
bioRxiv - Biophysics 2019
Quote:
... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ...
-
No products found
because this supplier's products are not listed.
Sandra M. Holmberg, et al.,
bioRxiv - Microbiology 2023
Quote:
... Slides were run in 3% acetic acid (VWR Chemicals) and stained with Alcian blue (Sigma‒Aldrich ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Xavier Prasanna, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Indole-3-acetic acid sodium (IAA, Santa Cruz, sc-215171, 500 µM); Human fibronectin (Roche Diagnostics ...
-
No products found
because this supplier's products are not listed.
Kwok Kin Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
No products found
because this supplier's products are not listed.
Ritu Nayak, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Jessica Y Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Craig McElroy, et al.,
bioRxiv - Biochemistry 2023
Quote:
... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Vi Pham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 6 ng/mL interleukin-3 (IL-3) (PeproTech, Rocky Hill, NJ) and 2 uL Lentiblast Premium Transduction Enhancer (OZBiosciences ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
Cat# HY-W015061-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Valeria Rudman-Melnick, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...