1 - 50 of 627
suppliers found for
6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine
» view 10000+ matched products-
Alfa Chemistry Sponsored
Cat# ACM214603971, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.Cited in Bacterial produce membrane-binding small molecules to regulate horizontal gene transfer in vesiclesbioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... (4-chloro-[2-(2-thienyl)imadazo[1,2a]pyridine-3-yl]benzamide (DS2) and GABA were obtained from Tocris Bioscience (Bristol ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in A tissue-engineered human trabecular meshwork hydrogel for advanced glaucoma disease modelingbioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018, published in Frontiers in Oncology doi: 10.3389/fonc.2019.00314Quote: ... rabbit anti-protein kinase B (AKT1, 2, 3) (Ab32505, Abcam) or rabbit IgG isotype control (Cell Signaling Technologies) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... (S)-Phosphoric acid mono-(2-octadec-9-enoylamino-3-[4-(pyridine-2-ylmethoxy)-phenyl]-propyl) ester (Ammonium Salt) (857340; Avanti Polar Lipids, Alabaster, Alabama, USA) was dissolved in 3% free-fatty acid BSA (FFA-BSA ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... 3 µM CHIR99021 (PeproTech, SM-2520691-B) and 0.2 µM PD0325901 (PeproTech ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2020Quote: ... Mouse IL-28 A/B (IFN-lambda 2/3) Du-oSet ELISA (DY1789B, R&D Systems), was used to assess cross-reactivity. -
Leica
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2018, published in GigaScience doi: 10.1093/gigascience/giy126Quote: ... we used microscopy system 3 (Leica DMi8, Table 2). -
Corning
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... followed by to a glass slide (2×3 inch, Corning) for durability ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... or the IGF-1R antagonist 7-[cis-3-(1-azetidinylmethyl)cyclobutyl]-5-[3-(phenylmethoxy)phenyl]-7H-pyrrolo[2,3-]pyrimidin-4-amine (NVP-AEW 541, 40 μM; Cayman Chemicals) plus IGF-1 were infused into the IL ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Journal of Cell Science doi: 10.1242/jcs.206334Quote: ... samples were incubated in increasing concentrations of Spurr resin solved in propanol (2:1, 1:2, 1:3 for 1h each step) (Polysciences Inc., Warminster, PA, UA). Afterwards ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in The Journal of Neuroscience doi: 10.1523/JNEUROSCI.1514-19.2020Quote: ... Novaplus) followed by freshly prepared 2% glutaraldehyde/2% paraformaldehyde in 0.1M PB solution filtered with #3 filter paper (VWR) and pH to 7.4 ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Disease Models & Mechanisms doi: 10.1242/dmm.040170Quote: ... AG1478 (used 2-3 µM, Calbiochem, cat. # 658552) and 6-BIO (0.2 µM ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4). -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Zoology 2020, published in Biomolecules doi: 10.3390/biom10070978Quote: ... The protein pellet was redissolved in 260 μl lysis buffer (6 M urea, 2 M thiourea, 4% CHAPS, 30 mM DTT, and GE Healthcare 2% IPG buffer pH 3–10). GE Healthcare IEF strips (pH 3–10NL ... -
Gold Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in The Plant Cell doi: 10.1105/tpc.19.00150Quote: ... 0.3% Triton X-100 and 2 mM 5-Bromo-4-chloro-3-indoxyl-beta-D-glucuronide cyclohexylammonium (X-gluc) (Gold Biotechnology, USA)) on multi-well plates ... -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: ... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 2-chloro-1,4-naphthoquinone was purchased from TCI America ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... A long tempered small tip (2 — 3 μm in diameter) patch pipette (∼3 MΩ; borosilicate glass, WPI, GBF 150-86-10) was used to pressure inject the dye into the extracellular space at 4 — 6 psi for 14 minutes ... -
MedChemExpress
Cat# HY-107371-10 mM * 1 mL, 10 mM * 1 mL, USD $79.0 AskbioRxiv - Immunology 2020Quote: ... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
Worthington Biochemical
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.Cat# LS005302, Bulk, Inquire AskbioRxiv - Developmental Biology 2019, published in Journal of the American Society of Nephrology doi: 10.1681/ASN.2020010052Quote: ... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Methods doi: 10.1038/s41592-019-0581-xQuote: ... Wide-field images (Fig.1, 2, 3, 5, 6) were acquired with a 4× objective (Olympus XLFluor 4x/340a); high-resolution images (Fig ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...