-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Wouter A. G. Beenker, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
No products found
because this supplier's products are not listed.
Haiyan Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Jennifer Fransson, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (S)-Phosphoric acid mono-(2-octadec-9-enoylamino-3-[4-(pyridine-2-ylmethoxy)-phenyl]-propyl) ester (Ammonium Salt) (857340; Avanti Polar Lipids, Alabaster, Alabama, USA) was dissolved in 3% free-fatty acid BSA (FFA-BSA ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Wouter A. G. Beenker, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Kwok Kin Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Jessica Y Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Sapir Herchcovici Levi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (PeproTech, SM-2520691-B) and 0.2 µM PD0325901 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
Cat# HY-107371-10 mM * 1 mL,
10 mM * 1 mL, USD $79.0
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Boštjan Kokot, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Lani Archer, et al.,
bioRxiv - Plant Biology 2022
Quote:
X-gluc (5-bromo-4-chloro-3-indolyl-b-D-glucopyranosiduronic acid) (Gold Biotechnology, St ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...