-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
King L. Hung, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were diluted 1:4 in hybridization buffer (Empire Genomics) and added to the sample with the addition of a slide ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Clémence Bernard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and (4) literature on interneuron connectivity (MEDLINE search for “gene name” and “synapse” and “interneuron”) ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Alec W. Stranahan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or Ara-C (LKT Laboratories, cat no: 147-94-4). For combination treatment studies with Zileuton (LKT Laboratories ...
-
No products found
because this supplier's products are not listed.
Nevena Paunović, et al.,
bioRxiv - Bioengineering 2020
Quote:
... a bronchoscope (Ambu® aScope™4 Broncho slim 3.8/1.2) was introduced into the trachea and the endotracheal tube slid over the endoscope to secure the airway ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
Cat# IMS217-Beads,
USD $245.0/4 x 1ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... The Catalyst One analyzer (IDEXX Laboratories) was used for biochemical analyses of serum samples ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Simona Pellecchia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... matched with the ones provided by Cellecta’s whitelist were used ...
-
No products found
because this supplier's products are not listed.
Wenxu Zhang, et al.,
bioRxiv - Bioengineering 2022
Quote:
De-identified human kidney tissue sections (30μm) were prepared from 4% v/v PFA-fixed frozen biopsy samples using a Compresstome (VF-210-0Z, Precisionary). Samples were imaged between 1mm thick glass slide and #1 thickness coverglass ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Miriam Marín-Menguiano, et al.,
bioRxiv - Microbiology 2019
Quote:
ER stress assays were carried out with cultures grown at 28 °C to exponential phase in CMD and spotted at 0.4 OD600 onto CM plates supplemented with 4 mM DTT (iNtRON Biotechnology). Plates were incubated for 48 h at 28 °C ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
Alan P. R. Lorenzetti, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Cell pellets were resuspended in Milli-Q water and disrupted at 4°C using ceramic beads (Mo Bio Laboratories) and a Precellys 24 homogenizer (Bertin Corp). Protein content was determined by bicinchoninic acid assay (BCA ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Steven Park, et al.,
bioRxiv - Microbiology 2022
Quote:
... Replicators with 96 one-millimeter pins (Boekel Industries # 140500) were sterilized in an autoclave before the start of the experiment and with an open flame between the transfer steps ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Lili Zhao, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cell viability was assessed over time for 4 days using the xCELLigence real-time cell analyser system and the RTCA software v1.2.1 (ACEA Biosciences, San Diego, CA, USA). To characterise T-cell activation ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Amy Cheung, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% Bovine Serum Albumin in TBST for 2 hours (mouse anti-SERT 1:7000, MAb Technologies, ST51-2 ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... SARS-CoV-2 pseudovirus productions were quantified by RETRO-TEK HIV-1 p24 ELISA according to manufacturer instructions (ZeptoMetrix Corporation).
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Melika Shahhosseini, et al.,
bioRxiv - Bioengineering 2022
Quote:
... supplemented with 2% heat-inactivated FBS (Atlas Biologicals), and 1mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...