-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... 6-diamidino-2-phenylindole ( DAPI) (Solarbio, C006, China) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Benjamin Furtwängler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with growth factors (Miltenyi Biotec, IL-3, IL-6 and G-CSF (10 ng/mL), h-SCF and FLt3-L (50 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Stefano Cattaneo, et al.,
bioRxiv - Neuroscience 2019
Quote:
All drugs were obtained from Sigma except 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt (NBQX) and 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)pyridazinium bromide (gabazine) which were obtained from Hello Bio (Bristol, UK).
-
No products found
because this supplier's products are not listed.
Peter Proks, et al.,
bioRxiv - Biophysics 2021
Quote:
... NFx and desamino chloro-fluoxetine (Toronto Research Chemicals). NFx was dissolved in DMSO and diluted to working concentrations on the day of experimenting (max final DMSO concentration was 0.3 %) ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Nathan C. Winn, et al.,
bioRxiv - Physiology 2022
Quote:
... and digested in 6 ml of 2-mg/mL type II collagenase (Worthington # LS004177) for 30 min at 37°C ...
-
Building Block
Sold for research purposes only.
Cat# 1028.0, SKU# 1028-100 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Lukas Weiß, et al.,
bioRxiv - Plant Biology 2021
Quote:
... methanol, 0.5 mg/ml X-gluc (1,5-bromo-4-chloro-3-indoxyl-β-D-glucuronic acid, cyclohexylammonium salt (Carbosynth, Bratislava, Slovak Republic), (Schweizer et al. ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Liam McCarthy, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
6-Methoxy-2-naphthoic acid (6-Methoxy-2-naphthalenecarboxylic acid) is an modulator of NMDAR.
Cat# S5302, SKU# S5302-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Christopher T. Schafer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Methoxy e-Coelenterazine (Prolume Purple) was purchased from Nanolight Technologies (Prolume LTD ...
-
No products found
because this supplier's products are not listed.
Fabrice C. Bernard, et al.,
bioRxiv - Bioengineering 2021
Quote:
40 kDa methoxy polyethylene glycol (PEG) amine (JenKem Technology) was purchased as a dry lyophilized powder for PEG tracer synthesis ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Chhiring Lama, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 6-diamidino-2-phenylindole (Spectral DAPI, Akoya Biosciences) was applied per provided protocols to label nuclei ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
6 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P06-1.5H-N,
20/case, $249.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Luna Jammal Salameh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... strains see above) were deeply anesthetized with isoflurane (1-Chloro-2,2,2-trifluoroethyl-difluoromethylether, Abbott, Germany). As described previously in more detail (Dutschmann et al. ...
-
No products found
because this supplier's products are not listed.
Monika Chodasiewicz, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Thermal unfolding of G-actin (2 μM) and F-actin (2 μM) was performed with the Tycho NT.6 (Nanotemper, Munich, Germany) according to the manufacturer’s instructions in G-buffer (5 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
AJ Brandner, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... a set of eight monofilaments at logarithmic intervals from 0.008 to 6 grams (0.008, 0.023, 0.07, 0.16, 0.4, 1, 2, and 6 grams; Stoelting, Wood Dale, IL) were applied to the center of the plantar surface of the left hind paw for up to 4 seconds using the up–down method (Chaplan et al. ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...