-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Dong Wang, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Valeria Rudman-Melnick, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Ludek Eyer, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2’-C-methyladenosine and 7-deaza-2’-C-methyladenosine were from Carbosynth (Compton, UK). For in vitro studies ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Andrea Salm, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Bharat Ravi Iyengar, Andreas Wagner,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 6-(2-deoxy-beta-D-ribofuranosyl)-3,4-dihydro-8H-pyrimido-[4,5-C] [1,2]oxazin-7-one triphosphate (dPTP, Trilink Biotechnologies), 200nM each of forward and reverse primers ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Prasanna Babu Araveti, et al.,
bioRxiv - Microbiology 2022
Quote:
... the fluorescence images of the HEK293 cells were captured using Axio Observer 7 microscope Apotome 2 (Carl Zeiss).
-
No products found
because this supplier's products are not listed.
Paulina M. Wojnarowicz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 and 6 hours after addition of the reagent using a plate reader (Synergy 2, BioTek).
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
6-Chloro-7-hydroxy-4-methylcoumarin is a pharmaceutical intermediate.
Cat# S5760, SKU# S5760-5mg,
5mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Stanimir Asenov Tashev, et al.,
bioRxiv - Cell Biology 2023
Quote:
Microscope II (data acquired: Fig. 2 and Supplementary Fig. 6) (Eclipse Ti; Nikon) was equipped for laser-scanning confocal optical microscopy (Flimbee ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Malvina Pizzuto, et al.,
bioRxiv - Immunology 2022
Quote:
... 24-well plates (500 μL/well) or 6-well plates (2 mL/well) (Greiner Bio-One). After 3 hours ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Alexey Kolodkin, et al.,
bioRxiv - Systems Biology 2019
Quote:
... PC12 (2×105 cells/well) were plated in 6-well plates (EuroClone) pre-coated with poly-L-lysine (0.1 mg/ml) ...
-
No products found
because this supplier's products are not listed.
Clara W. Liff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were permeabilized for 2 days and blocked in 6% goat serum (Jackson ImmunoResearch, 005-000-121) for 2 days at 37°C ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Esmi Lau Zajaczkowski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Hiroaki Kaku, Thomas L. Rothstein,
bioRxiv - Cell Biology 2019
Quote:
... after which cells were resuspended in 2 μg/ml 7-aminoactinomycin D (7-AAD) (Anaspec). Cell viability was assessed using Gallios (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Christopher J. Black, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A roughly ∼2-4mm craniotomy and 2-3 pilot holes were drilled using a micro drill (Stoelting). Stainless steel screws (000-120 ...
-
No products found
because this supplier's products are not listed.
Mathilde Bergamelli, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostainings were performed with the following antibodies: rabbit anti-Cytokeratin-7 (Genetex; 2 μg/mL), mouse anti-Vimentin (Santa-Cruz ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... while Lab 2 used Antibody 2 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Eva Dervas, et al.,
bioRxiv - Pathology 2020
Quote:
... followed by a 15 min incubation with DAPI (4′, 6-diamidino-2-phenylindole, Novus Biologicals; 1:10,000 in PBS). Sections were washed twice with distilled water ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Lok Man John Law, et al.,
bioRxiv - Microbiology 2021
Quote:
Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
No products found
because this supplier's products are not listed.
Dominick J. Jenkins, et al.,
bioRxiv - Biochemistry 2023
Quote:
Cultures containing expression plasmids were grown in 2-6 L of LB (Research Products International, RPI) containing 50 μg/mL kanamycin ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Gaëlle Hogrel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... These were diluted 2-fold with water and ultracentrifuged using 3 kDa MWCO spin filters (Pall). Liquid chromatography analysis was performed on the Dionex UltiMate 3000 system ...