1 - 50 of 631
suppliers found for
6 Chloro 2 3 Pyridine Dicarboxylic Acid
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 243835-70-3, Inquire Ask
-
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... (4-chloro-[2-(2-thienyl)imadazo[1,2a]pyridine-3-yl]benzamide (DS2) and GABA were obtained from Tocris Bioscience (Bristol ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... and 100 μM l-trans-pyrrolidine-2,4-dicarboxylic acid (PDC, Sigma- Aldrich) for 5 days ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... 2,4-Pyridine Dicarboxylic Acid (2,4-PCA) is purchased from Acros Organics (New Jersey, Catalog number 101860010). JIB-04 is purchased from Sigma-Aldrich (St ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... C-175) and 3-((2-methyl-1,3-thiazol-4-yl)ethynyl)pyridine hydrochloride (MTEP hydrochloride, Abcam, ab120035) were prepared in distilled water and diluted with saline to the required concentration. -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 14-eicosatrienoic acid (20:3 ω-6, sciadonic acid; Cayman Chemical, # 10009999), all cis-8 ... -
Merck
No products found because this supplier's products are not listed.Cited in Heterogeneity in PHGDH protein expression potentiates cancer cell dissemination and metastasisbioRxiv - Cancer Biology 2021Quote: ... in pyridine (Merck Sigma, 270970). Subsequently ... -
Gold Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2022Quote: ... X-GlcA ((5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid, Goldbio) in DMF (Dimethyl formamide) ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... (S)-Phosphoric acid mono-(2-octadec-9-enoylamino-3-[4-(pyridine-2-ylmethoxy)-phenyl]-propyl) ester (Ammonium Salt) (857340; Avanti Polar Lipids, Alabaster, Alabama, USA) was dissolved in 3% free-fatty acid BSA (FFA-BSA ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018Quote: ... β-galactosidase assays were performed on whole-mount embryos using salmon-gal (6-Chloro-3-indolyl-beta-D-galactopyranoside, Alfa Aesar, B21131). -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017Quote: ... 3 mM 3-mercaptopicolinic acid (3-MPA, Santa Cruz) was used to inhibit endogenous glucose production ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in Variable branching characteristics of peripheral taste neurons indicates differential convergencebioRxiv - Neuroscience 2021Quote: ... before incubating overnight at room temperature in 0.1 M Tris-HCl (pH 9.5) containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate at the recommended concentrations (Vector Laboratories). After washing in PBS and postfixing in 4% PFA ... -
MedChemExpress
Cat# HY-131272, inquire AskbioRxiv - Immunology 2020Quote: ... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 2-chloro-1,4-naphthoquinone was purchased from TCI America ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in eLife doi: 10.7554/eLife.50523Quote: ... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Scientific Reports doi: 10.1038/s41598-020-62089-6Quote: ... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018Quote: ... 0.1%Triton X-100) containing 0.5 mg/mL 5-bromo-4-chloro-3-indolyl ß-D-glucuronic acid (Calbiochem, La Jolla, CA, USA) was incubated at 37° for one hour ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020, published in RNA Biology doi: 10.1080/15476286.2020.1733798Quote: ... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water. -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... IL-3 and IL-6 (PeproTech 300-07 ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Infection and Immunity doi: 10.1128/iai.00019-19Quote: ... The membranes were washed 3 times in TBST for 15 minutes each and blots were developed with BCIP/NBT (5-bromo-4-chloro-3-indoyl-phosphate/nitro blue tetrazolium) color development substrate (VWR). -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in PLOS Biology doi: 10.1371/journal.pbio.3000471Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Structural and functional insights into nitrosoglutathione reductase from Chlamydomonas reinhardtiibioRxiv - Plant Biology 2020Quote: ... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Stem Cells International doi: 10.1155/2019/6041816Quote: ... 3 and 6 were stained with Calcein-AM (BIOLEGEND, 425201) and PI (SIGMA ... -
IRIS Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0226396Quote: ... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech). -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in PLOS ONE doi: 10.1371/journal.pone.0236850Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio). -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... 6 - trisulfonic acid (ProZyme, Inc., San Leandro, CA) at the reducing termini by reductive amination ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Biovision
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: JAK inhibitors pyridine-6 (BioVision, Cat No. 2534) and ruxolitinib (NCB018424 ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ... -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in RAB6 GTPase is a crucial regulator of the mammary secretory function controlling STAT5 activationbioRxiv - Developmental Biology 2020Quote: ... fixed in Methacarn (1/3/6 mixture of acetic acid/chloroform/methanol) overnight at room temperature and stained with carmine alum (Stem Cell Technologies), or fixed in 4% paraformaldehyde overnight at 4°C ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Frontiers in Neuroscience doi: 10.3389/fnins.2019.00201Quote: ... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ... -
Carbosynth
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... methanol, 0.5 mg/ml X-gluc (1,5-bromo-4-chloro-3-indoxyl-β-D-glucuronic acid, cyclohexylammonium salt (Carbosynth, Bratislava, Slovak Republic), (Schweizer et al. ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 6 (3M and 6M, mIPSCs), respectively. -
Envigo RMS
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkaa042Quote: ... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... cells were washed 3×3 minute in PBS and fixed for 30 minutes in 6% paraformaldehyde (Electron Microscopy Sciences 15710) in 1x PBS ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2022Quote: ... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...