-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
4-Chloro-3-nitropyridine is a chemical reagent.
Cat# abx183566-5G,
5 g USD $130.5
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
Cat# F4,
USD $18.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were fixed with 4% PFA at 4 days post-infection and processed with Immunohistochemistry (IHC) using mouse monoclonal anti-VZV antibody (Meridian Life Sciences C05108MA, 1:2000 diluted in PBS), followed by incubation with biotinylated anti-mouse IgG (Vector Laboratories #BA-9200) ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
P. Stalder, et al.,
bioRxiv - Systems Biology 2023
Quote:
... α-Synuclein purchased from rPeptide (Cat# S-1001-4) was used ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-mature SP-B (rabbit polyclonal, 1:1000, Seven Hills Bioreagents), both generous gifts from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Pedro Aguilar-Garrido, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were selected by blasticidin (2 μg/mL) (AG Scientific, CA, USA, Cat# B-1247) and hygromycin (400 μg/mL ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... were concentrated to 4 mg ml-1 and subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format with 100 nL protein mixed with 100 nL mother liquor in SwissSci 96-well triple drop plates and incubation at 20°C ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Jonas N. Conde, et al.,
bioRxiv - Microbiology 2021
Quote:
... hBMECs (passages 4 to 10) were purchased from Cell Biologics (H-6023) and grown in EC basal medium-2 MV (EBM-2 MV ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and SARS-CoV-2 lineage B.1.1.529 (Omicron Variant) culture fluid (UV inactivated, 0810642UV, Zeptometrix LLC, USA) and (heat inactivated ...
-
Native Antigen
Cat# NAT41581-100,
100µg USD $426.0
Ask
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2021
Quote:
... HNoV GII.4 virus-like particles (VLPs) were purchased from The Native Antigen Company, Poly (I:C ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Youwen Zhuang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cell cultures were grown to a density of 4×106 cells/ mL in ESF 921 serum-free medium (Expression Systems). For the expression of the DRD1-Gs complexes ...
-
No products found
because this supplier's products are not listed.
Molly A. Guscott, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Coverslips were blocked with 3% BSA and incubated with primary antibodies (RPA - ab79398, H2AX - Millipore-05-636, CREST - Antibodies incorporated - 15-234-0001). Then secondary antibodies (goat anti-rabbit AlexaFluor (AF)488 ...