-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5-Ethylthio-1H-tetrazole (ETT, Honeywell Research Chemicals, 0.25 M solution in acetonitrile) was used as an activator ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
John D. Graef, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Neural Supplement B (Cellular Dynamics, M1029), Nervous System Supplement (Cellular Dynamics ...
-
No products found
because this supplier's products are not listed.
Irina Fonseca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Cells were then incubated for 1h at RT with corresponding secondary antibodies Alexa Fluor 488 (Alfagene, #A11034) and Alexa Fluor 549 (Alfagene ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Jinge Gu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Hsp70 (StressMarq Biosciences Inc, SMC-100A/B), mouse anti-GAPDH (Proteintech ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Riley A. Suhar, et al.,
bioRxiv - Bioengineering 2021
Quote:
... for HA-B or Ald- CH2-PEG3-Azide (BroadPharm, BP-21715) for HA-A in extra-dry DMSO (100 mg mL-1 ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Matteo Lunghi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and trimethylsilylated shortly before analysis through addition of 20 μl N,O-bis(trimethylsilyl)trifluoroacetamide with 1 % trimethylchlorosilane (BSTFA-TMCS, Cerilliant, Sigma B-023). The GC-MS instrumentation and settings (electron ionization mode ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... coated overnight with 0.07 μg/μl collagen I (5005-B, Cell systems) diluted in 70% EtOH ...
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Kartika Padhan, et al.,
bioRxiv - Immunology 2020
Quote:
... We sorted 1-2 million cells from each cell types for experiments involving FCS2 chamber (Bioptechs) and 100,000-200,00 cells for experiments involving 8-well chamber (Lab-Tek) ...
-
No products found
because this supplier's products are not listed.
Francisco J. Cao-Garcia, et al.,
bioRxiv - Biophysics 2023
Quote:
... After HaloTag ligand functionalization the fluid chambers were passivated for at least 3 h with blocking buffer containing 1% w/v sulfydryl-blocked BSA (Lee Biosolutions) in 20 mM Tris-HCl pH 7.4 ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Qi Wang, et al.,
bioRxiv - Genomics 2023
Quote:
... and RNasin Plus (Promega)] 10-15 times using pestle A “loose” followed by pestle B “tight” 10-15 times (DWK Life Sciences, Millville, NJ, USA). Homogenate was passed through a 70 µm 1.5 ml mini strainer (PluriSelect ...
-
No products found
because this supplier's products are not listed.
Ilya A. Kalinin, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 1 mM (tris(2-carboxyethyl)phosphine (TCEP) in PBS) and divided into three microcentrifuge tubes for blocking with AMS (Setareh Biotech 6508), NEM or labeling buffer ...
-
No products found
because this supplier's products are not listed.
Emilie Boucher, et al.,
bioRxiv - Immunology 2022
Quote:
... and OVA-dextramer (H-2 Kb) (Immudex) (Table S2).
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Melika Shahhosseini, et al.,
bioRxiv - Bioengineering 2022
Quote:
... supplemented with 2% heat-inactivated FBS (Atlas Biologicals), and 1mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...