-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 6-Gingerol were obtained from Ark Pharm (Arlington Heights, IL). Atorvastatin was obtained from Selleckchem (Radnor ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ADP (0-5 μM; Bio/Data Corporation), collagen (0-50 μg/ml ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Andy He, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A Rosa26LSL-DNAJB1-PKA-GFP C56BL/6 founder mouse was generated and validated by Applied StemCell using a site-specific integrase via pronuclear injection [72] ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Jiang-An Yin, et al.,
bioRxiv - Genomics 2023
Quote:
... Viral titers of the sgRNA libraries were determined by a 6-point dose response in 6-well plates by puromycin selection and determination of live and dead cells (T.spiezzo, Cellecta) or flow cytometry of RFP+ cells (Brunello ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Diana N. Medina-Pérez, et al.,
bioRxiv - Microbiology 2020
Quote:
... B burgdorferi strains were grown in BSK-II media supplemented with 6% normal rabbit serum (Pel-Freez Biologicals, Rogers, AR) under conventional microaerobic conditions at 32°C ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Lingling Yin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and SL/KAR treatment using 5 μM rac-GR24 (Chiralix, Nijmegen, The Netherlands). For ChIP-seq experiments ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Carbonyl Fe powder (5-9 μm) was purchased from STREM Chemicals (Newburyport, MA, USA). Fe2O3 nanopowders (50-200 nm ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... slides were incubated in 95% ethanol for 5 min and counterstained with Eosin (Poly Scientific S1761GL) for 1-3 min ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).
-
No products found
because this supplier's products are not listed.
Inyup Paik, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A single colony was seed cultured overnight in 5 mL of superior broth (Athena Enzyme Systems, 0105). The next day ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
Aldosterone ELISA / assay Kit
Cat# K052-H5,
1.0 ea, USD $1285.0
Ask
Lara S. Hwa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 5 µl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays, Ann Arbor, MI), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Mason J. Appel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Colonies were picked manually (sublibraries 1 and 5 only) or using a PIXL robotic colony picker (Singer Instrument Company, Somerset, UK) at the Stanford University School of Medicine Genome Technology Center (Palo Alto ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
Rabbit polyclonal antibody against TCEAL3/5/6 protein. Immunogen region is C-terminal.
Cat# abx014953-10UG,
10 µg USD $50.75
Ask
Daniel C. Levine, et al.,
bioRxiv - Neuroscience 2024
Quote:
... hypothalamus from PER2-TgWT mice that were fasted for 16 hours or given ad libitum access to HFD for 1 week was excised at ZT16 and extracted with ∼5 volumes of strong RIPA buffer containing kinase and phosphatase inhibitors (Abbexa abx090624), sonicated in a water bath 3 x 30sec on high ...
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...