-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... Endothelium-intact or -denuded rings were mounted on tungsten wires and immersed in PSS at 37°C with constant gassing (21% O2 and 5% CO2) in a wire myography chamber (DMT 610) and incubated ex vivo with oxLDL (50μg/dL; 2h; Kalen Biomedical, cat. no. 770202-7), followed by normalization and KCL (100mM ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Yakun Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... We also used archived normal NHP tissue lung sections (from one rhesus macaque and one cynomolgus macaque) purchased from Zyagen (San Diego, CA) as controls.
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Murat Artan, et al.,
bioRxiv - Biochemistry 2022
Quote:
One ml of PureCube Ni-NTA agarose resin slurry (Cube Biotech, Germany) was transferred to a 15 ml Falcon tube ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Erin E Fowler, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 2D study mammograms were acquired from one of six Hologic (Hologic, Inc., Bedford, MA) mammography units ...
-
No products found
because this supplier's products are not listed.
Sarah Howald, et al.,
bioRxiv - Physiology 2021
Quote:
... The magnetic stirrers were connected to one stirrer controller (Rank Brothers Ltd., Cambridge, England). The chamber was closed with a custom-made glass lid with three metal ports ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Ty S. Maughon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and one induced pluripotent stem cell derived MSC cell-line (Cellular Dynamics International, Madison WI) (Lot #0003 ...
-
No products found
because this supplier's products are not listed.
Yuta Fujii, et al.,
bioRxiv - Plant Biology 2020
Quote:
One-day-old gemmalings were incubated in temperature-controlled incubators (IJ100, Yamato Scientific Co., LTD) and light conditions were adjusted using blue light-emitting diodes (LEDs ...
-
No products found
because this supplier's products are not listed.
L Pérez-Sisqués, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice sacrificed one week after behavioral testing with FD Rapid GolgiStain™kit (FD Neurotechnologies) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... to check for variability over time and ii) a one-way (GVS: LGVS vs. RGVS vs. Sham) ANOVA on the averaged proprioceptive drift values of the two visual capture conditions ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Jennifer McDonald, Catherine J. Merrick,
bioRxiv - Microbiology 2021
Quote:
Mature schizont cultures at >6% parasitaemia were synchronised using 55% Nycodenz (Alere technologies AS). Cultures were centrifuged and media removed to leave 2ml of media and blood ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Adam R. Barno, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The six complete circular phages containing at least one AMG were visualized using DNAplotter (Carver et al., 2009).
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Seeds harvested approximately one month after the transformation were screened on Murashige & Skoog (MS) medium plates (PhytoTechnology Laboratories) supplemented with hygromycin B (PhytoTechnology Laboratories ...
-
No products found
because this supplier's products are not listed.
Madeline R. Sponholtz, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Grids were loaded onto one of two transmission electron microscopes (TEMs): (i) a Japan Electron Optics Laboratory (JEOL) 2010F TEM or (ii ...
-
No products found
because this supplier's products are not listed.
Chai-An Mao, et al.,
bioRxiv - Neuroscience 2020
Quote:
One μl of anti-melanopsin conjugated with saporin (Melanopsin-SAP, 400 μg/ml, Advance Targeting System, San Diego, CA) was injected into the vitreous of the right eye of Tbr2TauGFP/+ mice using a 33-gauge NanoFil system (World Precision Instruments ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Haoyang Chen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... One tube (left side in Fig. S5a) was filled with defibrinated bovine blood (Lampire biological laboratories, Pipersville, PA, USA) while circulated using a peristatic pump (model 3386 ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Zhifen Cui, et al.,
bioRxiv - Microbiology 2021
Quote:
... were generated by simultaneously mixing one volume of lipid mixture (25 : 5: 19.3 : 0.8 : 50 molar ratio) of DLin-MC3-DMA (MedKoo Biosciences, #555308), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine ...
-
No products found
because this supplier's products are not listed.
Martín Klappenbach, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... followed by a variable period of time during which the animal was presented with one pellet of food (Bottom fish, Labcon) at the bottom of the container in the center of the StQ ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Fatima Abbas, et al.,
bioRxiv - Neuroscience 2023
Quote:
The mutated toxin AaH-IIR62K was the one described in a previous report [26] and it was produced by Smartox Biotechnology (Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Meilin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... four parts MRS+CQ broth was combined with one part Cleanascite™ Lipid Removal Reagent (Biotech Support Group #X2555-10) and shaken (220 rpm ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Jixing Li, Marco Lai, Liina Pylkkänen,
bioRxiv - Neuroscience 2023
Quote:
... This task differed from the prior minimal composition studies which have only used one matching or mismatching task picture (Bemis & Pylkkanen, 2011). The reason for our larger set of pictures was that this decreased the chance of an accurate response by chance ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 1 µg of each protein sample was separated in one dimension using 4-20% tris-glycine gels (Mini-PROTEAN TGX, Bio-Rad Laboratories, Inc.). A 1:6 dilution of the PageRuler Plus pre-stained protein ladder (10 µl ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Giovanni S. Offeddu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
MVNs were cultured using Vasculife Endothelial Medium (LL-0003, Lifeline) and pooled HUVECs (GFP-expressing, Angio-Proteomie, 6 million ml-1 after five passages) and nHLFs (Lonza ...