-
No products found
because this supplier's products are not listed.
C. Jenul, et al.,
bioRxiv - Microbiology 2023
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)phosphazene ions (Apollo Scientific, m/z 622.1978) located on a wick within the source was used ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... or anti-SARS CoV-2 nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 37°C). Antihuman ACE-2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Rachel Bezalel-Buch, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 39mer 8 atom 6 bp ICL (39+6 DMEDA ICL) were synthesized and purified as previously reported (33) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... purified from human plasma or serum by fractionation (purity of greater than 97% as determined by SDS-PAGE analysis) were purchased from Innovative Research, Inc ...
-
No products found
because this supplier's products are not listed.
Viktoriya Zhuravleva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-Syntaxin-6 (Synaptic Systems) + Alexa Fluor-647 to tag the trans-Golgi network (TGN) ...
-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... Flow-chambers were assembled from one glass slide and one coverslip separated by double-sided 0.12 mm tape (Grace Bio-labs) positioned between each hole in the glass slide ...
-
No products found
because this supplier's products are not listed.
Alexandra Chrysanthou, et al.,
bioRxiv - Bioengineering 2022
Quote:
Mesenchymal stem cells (P3-6, Promocell) were cultured in mesenchymal stem cell growth medium 2 (PromoCell) ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% of baby rabbit complement (Cedarlane) diluted in Expi medium was added ...
-
No products found
because this supplier's products are not listed.
Tony Ngo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The percentage of cells infected by virus was quantified by flow cytometry following staining of 10 µL of cells with 10 µL of PE-conjugated anti-gp64 antibody (Expression Systems, catalog #97-201) for 20 min in the dark at 4°C ...
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Kaiyi Jiang, et al.,
bioRxiv - Genomics 2022
Quote:
... Hepa 1-6 cells (American Type Culture Collection (ATCC) -CRL-1830) ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... UDP-[6-3H]GlcNAc (ART 1136, American Radiolabeled Chemicals), phosphatidylinositol ...
-
No products found
because this supplier's products are not listed.
Kanve N. Suvilesh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK5/6 (mouse, ACR 105, 1:100; Biocare Medical), thyroid transcription factor (TTF-1 ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Yisong Qian, et al.,
bioRxiv - Immunology 2021
Quote:
... NSP7 (97-096) and NSP8 (97-097) proteins were obtained from Prosci (Poway, CA). SARS-CoV-2 papain-like protease (DB604 ...
-
No products found
because this supplier's products are not listed.
Pushan Bag, et al.,
bioRxiv - Plant Biology 2022
Quote:
... H218O (97%; Larodan Fine Chemicals AB) was added (final enrichment of 10%) ...
-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Hang Gyeong Chin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... >97% purified porcine tubulin (rPeptide, # T-1201-1) and >99% purified bovine tubulin (MP-Bioscience ...
-
No products found
because this supplier's products are not listed.
John H. Klich, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RAFT CTA 2-cyano-2-propyl dodecyl trithiocarbonate (2-CPDT; >97%; Strem Chemicals) was used as received ...
-
No products found
because this supplier's products are not listed.
Shijie Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Di-docosahexaenoyl (22:6) bis (monoacylglycerol) phosphate (di-22:6-BMP) was measured in plasma and exosome-depleted urine and CSF by ultra-performance liquid chromatography – tandem mass spectrometry (UPLC-MS/MS) ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 0.3-30μM thrombin-receptor activating peptide 6 (TRAP-6; Cambridge Biosciences); 0.3-30μM U46619 (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Alex Chialastri, et al.,
bioRxiv - Genomics 2022
Quote:
... One layer of photoresist (Microchem, SU-8 2075) is spun onto a silicon wafer at a thickness of 100 μm ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... One scoop of 0.15 mm zirconium oxide beads (Next Advance; ZrOB015) was added to each tube and bacteria were lysed using a Bullet Blender (Next Advance ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Simona Notova, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 45% precipitant mix 6 Morpheus II (Molecular Dimensions) for SeMet protein ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
N Bhaskaran, et al.,
bioRxiv - Immunology 2021
Quote:
... and IL-6 ELISA kits were from Boster Bio (Pleasanton ...
-
No products found
because this supplier's products are not listed.
Martin Thunemann, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A tungsten extracellular microelectrode (FHC, 6-8 MΩ) was used to determine the location of the C1 whisker representation on the whisker-barrel cortex prior to electrode array placement ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Jan Niklas Hansen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Coverslips were mounted with one drop of Aqua-Poly/Mount (Tebu-Bio). The following antibodies were used ...
-
No products found
because this supplier's products are not listed.
H Brünner, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One Teflon coated stainless steel wire (0.005 inch bare, A-M systems) from the electrode interface board (EIB ...
-
No products found
because this supplier's products are not listed.
Brian D. Adair, et al.,
bioRxiv - Cell Biology 2019
Quote:
... L-Har and TRAP-6 were purchased from Bachem. ADP ...
-
No products found
because this supplier's products are not listed.
Sarah M. Glenn, et al.,
bioRxiv - Microbiology 2023
Quote:
... C57BL/6 wild type and iNOS knockout mutant (Kerafast) cell lines were grown at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sofía Lawrie, Rubén Moreno-Bote, Matthieu Gilson,
bioRxiv - Neuroscience 2021
Quote:
... but only in their one-lag covariances P1 = WP0 (Gilson et al., 2020).
-
No products found
because this supplier's products are not listed.
Guillem Casadevall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Crystals appeared within one day from the Index HT screen from Hampton Research Inc ...
-
No products found
because this supplier's products are not listed.
Xiaodong Duan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Each drive was loaded with closely aligned one optical fiber (230 um, RWD Life Science) and 4 tetrodes ...
-
No products found
because this supplier's products are not listed.
Ningning Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Each sample was aliquoted and one of them was added with ascorbate (Thomas Scientific LLC, C988F55) to a final concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Terry R. Suk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... cDNA was synthesized using 5X All-in-One RT Master Mix (Bio Basic cat# HRT025-10) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas Kehrer, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were resuspended in one volume buffer A (15 mM Tris-HCl pH 8 (Boston Bioproducts), 15 mM NaCl (Corning) ...
-
No products found
because this supplier's products are not listed.
Chih-Hsiang Chang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... One-fourth of each fraction was analyzed by nanoLC/MS/MS using a TripleTOF 5600 (SCIEX, Foster City, CA, USA) as described below.