-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Physiology 2020
Quote:
... or rec N-Shh (Shenandoah biotechnology) diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Jason A. Rothman, et al.,
bioRxiv - Systems Biology 2024
Quote:
We analyzed uric acid with the Salimetrics Salivary Uric Acid Assay kit (Salimetrics, Carlsbad, CA, USA). We mixed 10 uL of sample with 190 uL of uric acid reagent in duplicate following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Anti-N-WASP (pTyr256, WP2601) was purchased from ECM Biosciences. Anti-mouse horse radish peroxidase-conjugate (170-5947 ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Inc.)-conjugated cytokeratin 6 (CK6; NSJ Bioreagents, Cat # V2168) antibodies ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... Dehydroabietic acid was purchased from Pfaltz & Bauer (Waterbury, CT). Fluconazole was obtained from Fisher Scientific (Pittsburgh ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti Cav2.3 N-terminus 1:250 (Covalab, custom 1, HEK293 & brain), rabbit anti pS15 Cav2.3 1:500 (Covalab ...
-
No products found
because this supplier's products are not listed.
Élora Midavaine, et al.,
bioRxiv - Neuroscience 2023
Quote:
... coupling reagents (ChemImpex International) and N-methylpyrrolidinone (A&C American Chemicals Ltd) were HPLC grade ...
-
No products found
Sierra A. Harding, et al.,
bioRxiv - Paleontology 2023
Quote:
The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Gabriela Zurawska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mice received i.v.solution of liposomes containing clodronic acid (LIPOSOMA, #C-SUV-005) (5 ml/kg ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Marina Chan, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Recombinant purified N-terminal domain (NTD) of the SARS-CoV-2 was obtained from Leinco Technologies Inc (Cat #S853 ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
The serum progesterone levels (n=4) were measured using an ELISA assay (# K025-H1/H5 Arbor Assays, Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Jacob J. Haffner, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A total of 15 standards were purchased from AA Blocks (hyocholic acid, 13-docosenamide), AvaChem (lenticin) ...
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Jie Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 1% w/v deoxycholic acid (sodium salt)) supplemented with protease inhibitors (Bimake, Cat# B14001) followed by sonication ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a subset of rats (n=10) were retrograde traced with Fluorogold (Fluorochrome, 2% solution in sterile distilled H2O). Briefly ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Anna M. O’Brien, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Hydrochloric acid (36.5% to 38.0% solution in water) was purchased from Caledon Laboratories (Georgetown, Canada). Milli-Q (18.2 MΩcm ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... were immobilized on commercial N-hydroxysuccinimide (NHS) ester-activated microarray slides (CodeLink Activated Slides; SurModics, Eden Prairie, MN, USA) using a piezoelectric spotting device (S3 ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Yiran Wei, et al.,
bioRxiv - Neuroscience 2021
Quote:
All patients underwent maximal safe surgery using 5-aminolevulinic acid fluorescence (5-ALA, Medac, Stirling, UK) and neuro-navigation (StealthStation ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Joshua A. Beitchman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A single-barreled glass capillary with a filament (1.0 × 0.58 mm2, 6” A-M Systems, Inc., WA) was pulled to a tip using a Kopf Pipette Puller (David Kopf Instruments ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.