-
No products found
because this supplier's products are not listed.
Lufei Sui, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 7.5μM trichostatin A (TSA) 20μM 6-Chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide (SIRT1i) (EMD Millipore), 15μM SAHM1 (EMD Millipore) ...
-
No products found
because this supplier's products are not listed.
Serena Notartomaso, et al.,
bioRxiv - Neuroscience 2024
Quote:
... VU0360172 [N-cyclobutyl-6-(2-(3-fluorophenyl)ethynyl) pyridine-3-carboxamide] was purchased from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
No products found
because this supplier's products are not listed.
Rosemaria Serradimigni, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... N-[4-chloro-3-(trifluoromethyl)phenyl]-2-ethoxy-6-pentadecyl-benzamide (CTPB) (CAS #: 586976-24-1) (>99% purity) was purchased from Abcam (Cambridge, United Kingdom). For both chemicals ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Stéphane Koundrioukoff, et al.,
bioRxiv - Genetics 2023
Quote:
... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Oleg Mikhajlov, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-(cysarginylglycylaspartate-maleimidomethyl)cyclohexane-carboxamide] sodium salt (DOPE-RGD) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Invitrogen™ Marina Blue™ 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (Marina Blue™ DHPE ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Melanie Werner-Klein, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
No products found
because this supplier's products are not listed.
Rajagopal Ayana, et al.,
bioRxiv - Neuroscience 2021
Quote:
... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Yiming Fang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3×105 OVCAR3 cells were seeded with 3×105 CAFs in 6-well ultra-low attachment plates (Corning). At the time of seeding ...
-
No products found
because this supplier's products are not listed.
Odile Fabre, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2 mM 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR, Toronto Research Chemicals), or 500 ng/mL mouse recombinant Gremlin 1 (R&D Biosciences ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6-diamidino-2-phenylindole (DAPI) (Electron Microscopy Sciences, #17985-10) and viewed by confocal microscope (Leica SP8 ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Zhan Qi, et al.,
bioRxiv - Systems Biology 2020
Quote:
... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Robert C. Klipp, John R. Bankston,
bioRxiv - Biophysics 2022
Quote:
... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Marinelle Rodrigues, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 gr 4-Chloro-DL-phenylalanine (Alfa Aesar, cat. A13323), 15 gr agar per 1 L of media) ...
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...
-
Cat# HY-101708-1 mg,
1 mg, USD $120.0
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...