-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...
-
No products found
because this supplier's products are not listed.
Yuan-Wei Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2-Aminoethyl methane thiosulfonate hydrobromide (MTSEA) and [2-(trimethylammonium)ethyl] methane thiosulfonate bromide (MTSET) were purchased from Anatrace. CHIBA-3007 and desmethyl-CHIBA-3007 were generous gifts of Dr ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Pavel I. Deryabin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mounted using 2 % propyl gallate and analyzed using Olympus FV3000 confocal microscope (Olympus, Japan). To visualize F-actin cytoskeleton ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... 6-diamidino-2-phenylindole ( DAPI) (Solarbio, C006, China) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Liam McCarthy, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Benjamin Furtwängler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with growth factors (Miltenyi Biotec, IL-3, IL-6 and G-CSF (10 ng/mL), h-SCF and FLt3-L (50 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Aidan Pavao, et al.,
bioRxiv - Microbiology 2023
Quote:
... Ethyl [U-13C]2-hydroxybutyrate (Cambridge Isotope Laboratories, Inc.) approximated 2-hydroxybutyrate and 2-aminobutyrate signals ...
-
No products found
because this supplier's products are not listed.
Erez Yirmiya, et al.,
bioRxiv - Genetics 2023
Quote:
... chip activation was made with a freshly prepared mixture of N-hydroxysuccinimide (50 mM in water) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (195 mM in water) for 7.5 min in DPBS (Sartorius, SKU 02-023-5A) (flow rate of 10 μL/min) ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
John H. Klich, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RAFT CTA 2-cyano-2-propyl dodecyl trithiocarbonate (2-CPDT; >97%; Strem Chemicals) was used as received ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
Quinoline (1-Azanaphthalene, 1-Benzazine, Benzazabenzene, Benzopyridine) is a heterocyclic...
Cat# S6369, SKU# S6369-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Valerie Betting, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... RNA was transferred to Hybond Nx nylon membranes (Amersham) and crosslinked using EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Sigma) (Pall & Hamilton 2008). Membranes were pre-hybridized in Ultrahyb Oligo hybridization buffer (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
6 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P06-1.5H-N,
20/case, $249.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Luna Jammal Salameh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... strains see above) were deeply anesthetized with isoflurane (1-Chloro-2,2,2-trifluoroethyl-difluoromethylether, Abbott, Germany). As described previously in more detail (Dutschmann et al. ...
-
No products found
because this supplier's products are not listed.
Nicholas R. Smith, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Slides were mounted in n-propyl gallate solution and imaged on a Zeiss ObserverZ1 microscope with ApoTome optical sectioning (Carl Zeiss), and digitally scanned on a Zeiss Axio Scan.Z1 ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Mikala C. Mueller, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Ethyl 2-(bromomethyl)acrylate (EBrMA; Ambeed, Inc.) was added drop-wise at a 6x molar ratio to PEG-OH groups ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Chhiring Lama, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 6-diamidino-2-phenylindole (Spectral DAPI, Akoya Biosciences) was applied per provided protocols to label nuclei ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...
-
No products found
because this supplier's products are not listed.
Monika Chodasiewicz, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Thermal unfolding of G-actin (2 μM) and F-actin (2 μM) was performed with the Tycho NT.6 (Nanotemper, Munich, Germany) according to the manufacturer’s instructions in G-buffer (5 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...