-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
Cat# 84884-31-1,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
Recombinant Antigen
Cat# REC31719-100,
100µg USD $503.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...