-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Ievgeniia A. Tiukova, et al.,
bioRxiv - Microbiology 2019
Quote:
... Lipid classes were identified by comparison to external standards (TLC 18-4A, Nu-Chek Prep, Elysian ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Lopamudra Sadhu, et al.,
bioRxiv - Immunology 2022
Quote:
... Raji B cells were stained with Cell trace Deep Red (10μM, Thermo Fischer) at 1:1000 dilution for 1h and simultaneously loaded with Staphylococcal enterotoxin E (SEE, Toxin Technology) at a concentration of 5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Richard L Youngblood, et al.,
bioRxiv - Bioengineering 2019
Quote:
... placed on a 9-Position stir plate (Chemglass) set at rotation rate of 95 rpm in a 37°C incubator ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... IMPACT Mouse FELASA and MKPV testing and was authenticated by CellCheck human 9 Test (9 Marker STR Profile and Inter-species Contamination Test) (IDEXX Analytics, Kornwestheim, Germany). H295R cells stably expressing a doxycycline inducible β-Catenin shRNA (pTer1 shRNA vector ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Feng He, et al.,
bioRxiv - Cell Biology 2020
Quote:
... in methanol:chloroform (9:1 v/v) solvent was loaded on to 0.45 µm supported nitrocellulose membrane (GVS, Sanford, ME). The membrane was air-dried for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Hemant K Srivastava, Sharba Bandyopadhyay,
bioRxiv - Neuroscience 2020
Quote:
9 animals were injected with 200 nl of green retrobeads (Lumafluor) into OFC and 3 of them were also injected with 100 nl of anterograde tracing AAV.CB7.CI.mCherry in MGBv using Nanoject II ...
-
No products found
because this supplier's products are not listed.
Michael Manoharan Valerio, et al.,
bioRxiv - Immunology 2023
Quote:
... and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9). Guide-RNA sequences targeting mouse β2m ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-sheep secondary antibodies (1:2000 in PSBT + 4% milk powder, ImmunoReagents) as appropriate for 45 mins at room temperature ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
ELISA, ICC/IF
Cat# CDC-29,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Rodney M. Ritzel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and resuspended in an intracellular antibody cocktail containing cytokine antibodies (MMP-9-R-PE, StressMarq Biosciences (SMC-396D); TNF-PE-Cy7 ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
George R. Nahass, et al.,
bioRxiv - Biochemistry 2020
Quote:
... We preloaded plates with 6 glass or silica beads (1 mm in diameter, BioSpec Products or 0.8 mm, OPS Diagnostics, respectively) per well ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were fixed with 4% PFA at 4 days post-infection and processed with Immunohistochemistry (IHC) using mouse monoclonal anti-VZV antibody (Meridian Life Sciences C05108MA, 1:2000 diluted in PBS), followed by incubation with biotinylated anti-mouse IgG (Vector Laboratories #BA-9200) ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Laura M. Chambers, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cells were plated at 65 % confluence in a 100 mm dish and cultured in 9 mL DMEM supplemented with heat inactivated 10% FBS (Atlas Biologicals Cat # F-0500-D, Lot F31E18D1)[15] ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tiphaine Péresse, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 1% antibiotics (Zell Shield, Minerva Biolabs) and were incubated at 37°C in a 5% CO2 humidified atmosphere ...