-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The BC-1471 compounds (TargetMol, CAS 896683-84-4 and CAS 896683-78-6) were also evaluated with STAMBPJAMM under identical conditions with a final concentration of 1 μM ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Primary antibody was applied overnight at 4°C for PDE11A (Fabgennix PD11-101 at 1:500). The following day ...
-
No products found
because this supplier's products are not listed.
Bojana Radojevic, et al.,
bioRxiv - Cell Biology 2020
Quote:
Retinal organoids were fixed in 4% paraformaldehyde (FD neuroTechnologies) at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... and went through overnight staining at 4°C with anti-BrdU (1:300, rat, Accurate Chemical Co. #OBT0030). On the second day ...
-
No products found
because this supplier's products are not listed.
Benjamin D. Gastfriend, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EZ spheres were passaged every Friday by mechanical dissociation with 2–4 passes on a McIlwain Tissue Chopper (Campden Instruments, Loughborough, United Kingdom), with half of the resulting aggregates returned to the flask and half discarded ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Francesca Murganti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were fixed with 4% formaldehyde solution in PBS for 10 min and stained overnight at 4 °C with primary antibodies against mVenus (1:800, Biorbyt, orb334993) and mCherry (1:250 ...
-
No products found
because this supplier's products are not listed.
Xiaojun Li, Angelika Doetzlhofer,
bioRxiv - Developmental Biology 2020
Quote:
... and expansion medium and plated into pre-warmed 4-well plates (CELLTREAT, no. 229103). For mice stage P2 ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Sachiko Haga-Yamanaka, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HDAC 4 (50064 and 50076, BPS Bioscience, San Diego, CA), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonas N. Conde, et al.,
bioRxiv - Microbiology 2021
Quote:
... hBMECs (passages 4 to 10) were purchased from Cell Biologics (H-6023) and grown in EC basal medium-2 MV (EBM-2 MV ...