-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
Carbohydrate
Cat# GOS0246S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For experiments with endogenous FXR agonists: Chenodeoxycholic Acid (endogenous bile acid, FXR agonist, LKT Labs) and Obeticholic Acid (cholic acid derivative ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... with 14.16□g of HEPES acid (STREM Chemicals) and 16.65 g of HEPES sodium salt (STREM Chemicals) ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Gabriela Zurawska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mice received i.v.solution of liposomes containing clodronic acid (LIPOSOMA, #C-SUV-005) (5 ml/kg ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Andrew V. Grassetti, Rufus Hards, Scott A. Gerber,
bioRxiv - Cell Biology 2021
Quote:
... lyophilized peptides were dissolved in 50% acetonitrile (ACN; Honeywell) / 2M lactic acid (Lee Biosolutions), incubated with 1.25 mg TiO2 microspheres (GL Sciences ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... At least two sections per mouse were stained with an acid-fast stain (Diagnostic BioSystems) according to the manufacturer’s instructions and visualized by an Olympus BH2 light microscope.
-
No products found
because this supplier's products are not listed.
Francis L. Fontanilla, et al.,
bioRxiv - Microbiology 2024
Quote:
HEp2 cells were seeded onto 12 mm acid-etched glass coverslips (Chemglass, CLS-1760-012) placed in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... The plate was left to incubate for 6 hours followed by addition of the ESF-AF medium (Expression systems). Sf9 cells were left for seven days at 27 °C without agitation ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Jason A. Rothman, et al.,
bioRxiv - Systems Biology 2024
Quote:
We analyzed uric acid with the Salimetrics Salivary Uric Acid Assay kit (Salimetrics, Carlsbad, CA, USA). We mixed 10 uL of sample with 190 uL of uric acid reagent in duplicate following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Azide-SS-biotin (6) was purchased from Broadpharm. Biotin-Diazo-azide (9) ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Alexander E. Vlahos, et al.,
bioRxiv - Bioengineering 2020
Quote:
... mycophenolic acid (Myfortic, Novartis) and FTY-720 (fingolimod, Biorbyt). ALS was administered as a single i.p ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
Ionel Sandovici, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Insulin levels in acid–ethanol supernatants were measured using ELISA kits (Mercodia – 10-1247-01). Total pancreas insulin content (pmol/L ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Arash Farhadi, et al.,
bioRxiv - Bioengineering 2019
Quote:
... cells cultured in 6-well plates were lysed with 400 µL of Solulyse-M (Genlantis Inc) per well for one hour at 4 °C ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Bone marrow cells were isolated from wild-type C57BL/6 mouse femurs and differentiated to bone marrow-derived macrophages (BMDM) using murine GM-CSF (50ng/mL, Tonbo Biosciences) in DMEM (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.