-
No products found
because this supplier's products are not listed.
Sayantani Pramanik Palit, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The treatment was continued daily for 6 weeks along with 5-bromo-2’-deoxyuridine (BrdU) (MP Biomedicals, India) on alternative days (100mg/kg bw i.p.) ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Xavier Grau-Bové, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Martin Alcorlo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... JBScreen Classic 1-4 and 6 (Jena Bioscience) and Crystal Screen ...
-
No products found
because this supplier's products are not listed.
Martin Baccino-Calace, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Larvae were dissected and sharp-electrode recordings were made from muscle 6 in abdominal segments 3 and 4 using an Axoclamp 900A amplifier (Molecular Devices). The extracellular HL3 saline contained (in mM) ...
-
No products found
because this supplier's products are not listed.
LN Marziali, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cells were incubated with 4’,6-diamidino-2-phenylindol (DAPI; 1 μg/ml) and the corresponding Alexa Fluor-conjugated secondary antibodies (1:500; Jackson ImmunoResearch Laboratories) for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Shang Shen, et al.,
bioRxiv - Microbiology 2023
Quote:
... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
No products found
because this supplier's products are not listed.
Shulan Xiao, Saumitra Yadav, Krishna Jayant,
bioRxiv - Neuroscience 2022
Quote:
... 4 to 6 MΩ borosilicate patch pipette (Sutter Instruments, CA, USA) were pulled using a P1000 pipette puller (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Miqdad O. Dhariwala, et al.,
bioRxiv - Immunology 2020
Quote:
... and skin was minced finely with dissection scissors and mixed in a 6-well plate with 3 ml of digestion buffer consisting of 0.8 mg/ml Collagenase Type 4 (4188; Worthington), 0.02 mg/ml DNAse (DN25-1G ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Jue Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... Cells were then washed and counterstained with 4’,6-diamidino-2-phenylindole (DAPI) Vectashield mounting medium and imaged by laser confocal fluorescence microscopy (Olympus).
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Michael Brandon Ware, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-IL-6 or anti-CTLA-4 antibodies (BioXCell). For CXCR3 blockade studies ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Conor J. Sugden, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The skin was then dissected into 2-3 mm2 pieces using a surgical scalpel and 3 or 4 pieces placed per well of a 6-well dish (Greiner Bio-One, Kremsmünster, Austria) with the dermis in contact with the dish ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Sophie Lanciano, et al.,
bioRxiv - Genomics 2023
Quote:
Two micrograms of genomic DNA were sonicated for 6 cycles (6 s on, 90 s off) at 4 °C with a Bioruptor NGS (Diagenode), generating average fragments of 1 kb ...
-
No products found
because this supplier's products are not listed.
Rachel Wong, Deepta Bhattacharya,
bioRxiv - Immunology 2020
Quote:
... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Michele Bortolomeazzi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Akoya Biosciences) and coverslipped using ProLong Gold antifade mounting media (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Nicholas Dillon, et al.,
bioRxiv - Microbiology 2020
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)-phosphazene (SynQuest Labs, Inc.) was used as a “lock mass” internal calibrant (m/z 622.028960 ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Thomas I. R. Hopkins, et al.,
bioRxiv - Biophysics 2021
Quote:
... 100% (3 × 1h)) and then placed in Histoclear (Cat. No HS-200, National Diagnostics) overnight ...
-
No products found
because this supplier's products are not listed.
Ryann M. Fame, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5–10 μL of CSF or serum was extracted in 4:6:3 chloroform:methanol:water mixture supplemented with isotopically labeled T3 and T4 (at 100 nM, Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Eva Dervas, et al.,
bioRxiv - Pathology 2020
Quote:
... followed by a 15 min incubation with DAPI (4′, 6-diamidino-2-phenylindole, Novus Biologicals; 1:10,000 in PBS). Sections were washed twice with distilled water ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Ulrich Hohmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and incubated for 1h at 4 °C before being added to 10 µl magnetic V5 beads (v5tma, Chromotek), pre-equilibrated in buffer K ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Kailin Yin, et al.,
bioRxiv - Immunology 2023
Quote:
... 6 million cells were resuspended in 4 ml of PBS (Rockland) containing 2 mM EDTA (Corning ...
-
No products found
because this supplier's products are not listed.
A. Rouf Banday, et al.,
bioRxiv - Genomics 2020
Quote:
... HEK293T cells (4 × 105 cells/ 6-well dish) were transfected using LT1 reagent (Mirus Bio) with HDV-EGFP (1 ug) ...
-
No products found
because this supplier's products are not listed.
Anjali Sengar, et al.,
bioRxiv - Microbiology 2023
Quote:
... The membrane was blocked with 5% BSA in TBS containing 0.1% tween-20 (TBS-T) for 1h at 4 °C before incubating with anti-S2 Spike primary antibody (rabbit polyclonal, Sino Biologicals, Cat#: 40590-T62) at 1:1,000 dilution in TBS-T with 5% BSA for 14-16 h at 4°C ...