-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Yuling Han, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 0.1 mM IBMX (3,7-dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dione) (Sigma Aldrich)) ...
-
No products found
because this supplier's products are not listed.
H. Hendrix, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Benedetta Sposito, et al.,
bioRxiv - Immunology 2022
Quote:
... gasderminC-2/-3 (Rabbit monoclonal; 229896; Lot# GR3317481-6; abcam), gasdermin D (Rabbit polyclonal ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Faiza Islam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1-benzyl-1,4-dihydro-3-pyridinecarboxamide (BNAH) was purchased from TCI Chemicals ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Masayo Omura, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-methyl-2,4-nonanedione was purchased from Santa Cruz Biotechnology and Combi-Blocks.
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Tuan Minh Tran, et al.,
bioRxiv - Plant Biology 2020
Quote:
DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Suvadip Mallick, et al.,
bioRxiv - Microbiology 2019
Quote:
... 6-diamidino-2-phenylindole (Vector Laboratories Inc.) and observed under Zeiss Apotome microscope at the specified magnification ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Shunya Kaneko, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Rajagopal Ayana, et al.,
bioRxiv - Neuroscience 2021
Quote:
... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
No products found
because this supplier's products are not listed.
Bidisha Mitra, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Bethany A Stahl, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Embryos were mounted in 3% hydroxypropyl methyl cellulose (VWR, cat# 200012-722) in E3 medium (ref) ...
-
No products found
because this supplier's products are not listed.
Sreyoshi Mitra, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
No products found
because this supplier's products are not listed.
Davide Sala, et al.,
bioRxiv - Genetics 2021
Quote:
... 6-diamidino-2-phenylindole (Hoechst; Roche, Rotkreuz, Switzerland) for nuclei ...
-
No products found
because this supplier's products are not listed.
Helena Shomar, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Samaresh Malik, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Yiming Fang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3×105 OVCAR3 cells were seeded with 3×105 CAFs in 6-well ultra-low attachment plates (Corning). At the time of seeding ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Methyl Methacrylate/Butyl Methacrylate (Electron Microscopy Sciences, Cat ...
-
No products found
because this supplier's products are not listed.
Daniel F. Comiskey Jr., et al.,
bioRxiv - Cancer Biology 2019
Quote:
2’O-methyl SSOs were provided by Trilink BioTechnologies ...
-
No products found
because this supplier's products are not listed.
Bethany C. Taylor, et al.,
bioRxiv - Systems Biology 2024
Quote:
... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
Cat# HY-137473,
inquire
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Robert C. Klipp, John R. Bankston,
bioRxiv - Biophysics 2022
Quote:
... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Shivathmihai Nagappan, Kevin M. Franks,
bioRxiv - Neuroscience 2021
Quote:
... and methyl tiglate (Alfa Aesar, A11964).
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).