-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Jiajun Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Histopathological analysis of kidneys (n=32) was conducted by IDEXX BioAnalytics (Columbia ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Nisha Dhanushkodi, et al.,
bioRxiv - Immunology 2022
Quote:
... HSV-2 DNA copy number was determined using purified HSV-2 DNA (Advanced Biotechnologies, Columbia, MD) and based on a standard curve of the CT values ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
High precision microscopy coverslips (round, 25 mm in diameter; Marienfeld) in Teflon holders (Wash-N-Dry Coverslip Rack; Diversified Biotech Inc.) were cleaned by incubation at 56°C overnight in 2% Hellmanex III (Hellma Analytics ...
-
No products found
because this supplier's products are not listed.
Christopher J. Emig, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... SARS-CoV-2 Delta Variant pseudovirus (eEnzyme) was diluted 1:2 in DMEM complete media to a pseudoviral particle concentration of 5e7/ml ...
-
No products found
because this supplier's products are not listed.
Yun Liu, Weichun Lin,
bioRxiv - Neuroscience 2022
Quote:
... μ-conotoxin GIIIB (2 μM; Peptides International) was added to the bath solution 30 minutes prior to recording ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
Recombinant AAV-2 VP1 Protein was expressed in E. coli.
Cat# VP1-1787A,
10ug , USD $298
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Camilla Margaroli, et al.,
bioRxiv - Pathology 2022
Quote:
... Anti-SARS-CoV-2 was conjugated to PE / R-Phycoerythrin (Expedeon Lightning-Link R-PE Conjugation Kit / Abcam ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 25-gauge butterfly needle attached to a peristaltic pump (#Minipuls 2; Rainin). Brains were removed and postfixed overnight at 4°C and then cut into 50 µm coronal sections using a vibratome (#TPI1000 ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2 Bacteriological (Neogen)] or Scm-his agar (containing CSM-histidine in place of CSM-uracil) ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... 15 mg/kg n=5) was collected using 21-G needles into plastic syringes containing corn trypsin inhibitor (Molecular Innovations, Southfield ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
J Paes de Faria, et al.,
bioRxiv - Neuroscience 2022
Quote:
... interleaved with the incubation with 4,6-diamidino-2-phenylindole (DAPI, Alfagene) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Amanda J. Stock, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2-mercaptoethanol) at 37°C in a Jitterbug Microplate Shaker (Boekel Scientific). After 30 minutes (min ...