-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 0.3-30μM thrombin-receptor activating peptide 6 (TRAP-6; Cambridge Biosciences); 0.3-30μM U46619 (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
LC Laboratories' Product Number L-7962 - LY 294002, Free Base...
Cat# L-7962, SKU# L-7962_50mg,
50 mg, $40.00
Ask
Josh Tycko, et al.,
bioRxiv - Systems Biology 2023
Quote:
... in one well 100 nM Rapamycin (LC Laboratories) was added and the other well contained regular RPMI complete media ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% of baby rabbit complement (Cedarlane) diluted in Expi medium was added ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pepin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... blood glucose levels were measured after an overnight fasting of 15 hours (± 1 hour) with one drop of blood from the tail-tip using a glucometer (Accu-Chek Aviva Nano).
-
No products found
because this supplier's products are not listed.
Michal M. Milczarek, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... 1 µL of each SC dilution were dispensed into separate wells of one column of a deep welled (1 mL) 96-well polypropylene plate (Phree, Phenomenex, USA). 100 µL untreated homogenized brain was aliquoted into each well (giving final concentrations of 10 ...
-
No products found
because this supplier's products are not listed.
Danny Galleguillos, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-[(1R,2R)-1-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl)-1-hydroxy-3- (pyrrolidin-1-yl)propan 2-yl] nonanamide (GENZ-123346) was obtained from Toronto Research Chemicals (TRC G363450) and solubilized in DMSO ...
-
No products found
because this supplier's products are not listed.
Olivia D. Nigro, et al.,
bioRxiv - Microbiology 2021
Quote:
... mixed cellulose ester filters (47 mm, GN-6; Pall) and filters were placed face-up on the vibrio-selective medium CHROMagar Vibrio (DRG Intl.) ...
-
No products found
because this supplier's products are not listed.
Sarah M. Glenn, et al.,
bioRxiv - Microbiology 2023
Quote:
... C57BL/6 wild type and iNOS knockout mutant (Kerafast) cell lines were grown at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Peter Njenga Ng’ang’a, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 6 × 104 cells in 1 mL DMEM medium (Pan Biotech) were grown for 48 h before addition of 5.8 nM of toxin ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Nuria Masachs, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
No products found
because this supplier's products are not listed.
Jiapeng Deng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one containing horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibodies (1:5000, Bioworld, Atlanta, GA, USA) and the other containing HRP-conjugated goat anti-rabbit antibodies (1:5000 ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml, clone MH16-1, Sanquin Reagents). After a final five-times wash ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 6-8 μM (Spherotech) were washed twice with wash buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Adrienne R. Guarnieri, et al.,
bioRxiv - Physiology 2021
Quote:
... IL-6 (Bioss BSKM1004) and TNF-α (Bioss BSKM1002 ...
-
No products found
because this supplier's products are not listed.
Ophir Vermesh, et al.,
bioRxiv - Bioengineering 2021
Quote:
Six one-liter chambers (Braintree Scientific, Braintree, MA) were operated in parallel for simultaneous mouse limonene measurements (Fig ...
-
No products found
because this supplier's products are not listed.
Govind Nair, et al.,
bioRxiv - Bioengineering 2024
Quote:
... via vortexing for one minute (IKA MS3 Vortexer) and spun down for one minute (MyFuge C1012 ...
-
No products found
because this supplier's products are not listed.
Félix Velando, et al.,
bioRxiv - Microbiology 2024
Quote:
... One-microliter capillary tubes (P1424, Microcaps; Drummond Scientific) were heat-sealed at one end and filled with either the chemotaxis buffer (negative control ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... Flow-chambers were assembled from one glass slide and one coverslip separated by double-sided 0.12 mm tape (Grace Bio-labs) positioned between each hole in the glass slide ...
-
No products found
because this supplier's products are not listed.
Alexandra Chrysanthou, et al.,
bioRxiv - Bioengineering 2022
Quote:
Mesenchymal stem cells (P3-6, Promocell) were cultured in mesenchymal stem cell growth medium 2 (PromoCell) ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Philipp Gaugler, et al.,
bioRxiv - Plant Biology 2022
Quote:
... They were then diluted 1:200 in 2 mL fresh medium supplemented with 6 μCi mL−1 [3H]-myo-inositol (30–80 Ci mmol−1; Biotrend; ART-0261-5) and grown overnight at 28°C in a spinning wheel ...
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Simone Caielli, et al.,
bioRxiv - Immunology 2023
Quote:
... Inserts were introduced into the pCDH-CuO-MCS-EF1a-CymR-T2A-Puro SparQ™ All-in-one Cloning and Expression Lentivector (QM800A-1, System Biosciences). The correct sequence of the gene of interest (GOI ...
-
No products found
because this supplier's products are not listed.
Minal Engavale, et al.,
bioRxiv - Immunology 2023
Quote:
... Portions of the blot were incubated with one of the following primary antibodies for 2 hours at room temperature or overnight: anti-human Dnase1L3 (1:1000) (Abnova and Genetex), pre-immune rabbit serum (1:5000) ...
-
No products found
because this supplier's products are not listed.
Sachin N. Davis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 1 µl aliquots of the slurry were then spotted onto 6-well 0.4 µm polyester transwell membranes (CellTreat, 230607) overlying TeSR-E6+ and 7µM CHIR 99021 media for 2 hr ...
-
No products found
because this supplier's products are not listed.
Roy A. Ehling, et al.,
bioRxiv - Immunology 2021
Quote:
Transfected cells were sorted for HDR+ by staining for Strep-Tactin-APC 1:100 (IBA lifesciences, Cat: 6-5010-001) and anti-hIgG AF488 1:100 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Tianhu Sun, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and LHCB1-6 (Cat#AS01011) antibodies were purchased from Agrisera. A secondary goat-anti-rabbit HRP-conjugated antibody (BioRad cat#1706515 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Emily E Whittle, et al.,
bioRxiv - Microbiology 2021
Quote:
... One assay used MOPs minimal media (Teknova) which was supplemented with 400 mg/L histidine.
-
No products found
because this supplier's products are not listed.
Hoai Thi Thu Tran, et al.,
bioRxiv - Microbiology 2022
Quote:
... Luminescence (one-step luciferase assay system, Biomol) was detected after 15 min using a multi-plate reader (Tecan Group Ltd ...
-
LSF inhibitor
Sold for research purposes only.
Cat# 2157.0, SKU# 2157-50 mg,
50mg, US $368.50 / EA, EURO, €335 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Silvia Ferrara, et al.,
bioRxiv - Microbiology 2020
Quote:
... The lungs were washed with three one ml of RPMI-1640 (Euroclone) with protease inhibitors (Complete tablets ...
-
No products found
because this supplier's products are not listed.
Kai Guo, et al.,
bioRxiv - Immunology 2021
Quote:
... One million cells were stained with Ghost Dye-BV510 (Tonbo Biosciences, San Diego, CA) and anti-mouse CD16/CD32 (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Ningning Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Each sample was aliquoted and one of them was added with ascorbate (Thomas Scientific LLC, C988F55) to a final concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Thomas Kehrer, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were resuspended in one volume buffer A (15 mM Tris-HCl pH 8 (Boston Bioproducts), 15 mM NaCl (Corning) ...
-
No products found
because this supplier's products are not listed.
Christina Strauch, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and nuclei were visualized using 4’,6-diamidino-2-phenylindole (DAPI) in mounting medium (SCR-038448; Dianova, Hamburg, Germany).