-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Junfeng Shi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4h post 1.4Gy total body irradiation using the RS2000 Pro irradiator (Rad Source, Buford, GA, USA). The engraftment levels of hCD45+ cells were determined 12 weeks post-HPSCs transplantation by flow cytometric quantification of peripheral blood human CD45+ cells ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
Exendin 4 (1-8) is a peptide.
Cat# abx266042-5MG,
5 mg USD $304.5
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Kazuaki Maruyama, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Prox1 (11-002, AngioBio, 1:200; AF2727, R&D Systems, 1:200), LYVE1 (AF2125 ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Roberth Anthony Rojas Chávez, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 1 mM dithiothreitol) and 50 μl of 1 mM D-luciferin potassium salt (Syd Labs, MA) were added to each sample ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-sheep secondary antibodies (1:2000 in PSBT + 4% milk powder, ImmunoReagents) as appropriate for 45 mins at room temperature ...
-
No products found
because this supplier's products are not listed.
Bryan B. Yoo, et al.,
bioRxiv - Physiology 2021
Quote:
... and PCR are prepared and added in approximately 1:8 scale volumes using a Mosquito HV micropipetting robot (TTP Labtech). Fragmentation is performed at 37□°C for 20□min ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Oluwaseun M. Ajayi, et al.,
bioRxiv - Physiology 2022
Quote:
... Mosquito eggs were produced from 4-5 weeks old females through artificial feeding (Hemotek, Blackburn, United Kingdom) with chicken or rabbit blood (Pel-Freez Biologicals, Rogers, AZ, USA). Upon egg hatching ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Raissa R. Christoff, et al.,
bioRxiv - Neuroscience 2021
Quote:
... aliquots were centrifugated and washed trice in 0.1M PBS (1,500RPM, 5 min each) and then incubated with 1:200 mouse anti-SATB21:200 (GenWay 20-372-60065) in blocking solution (2μl BSA 5% ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with and stained in 5 % milk in TBST and detected using WesternBright ECL Western Blotting detection kit (#K-12045-D20, Advansta). For Coomassie Blue staining ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Julie Van Coillie, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 levels in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) using IL-6 CT205-c and CT205-d antibody pair (U-CyTech, Utrecht, the Netherlands) as described previously (1).
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, Sean G. Megason, Chenghua Gu,
bioRxiv - Developmental Biology 2019
Quote:
... 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ∼1.114 particles/ml in PBS) were injected into the cardiac sac just as for the fluorescently conjugated tracers ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Paul B. Finn, et al.,
bioRxiv - Biochemistry 2020
Quote:
... (R)-2,4-Fmoc-Dab(Boc)-OH (α-amino-GABA turn) was purchased from Peptides International. Monomers were synthesized as previously described [32] ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 5 µg/mL HIV-1 JR-CSF gp120 (Immune Technology) in coating buffer ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Wei Wei, et al.,
bioRxiv - Biochemistry 2024
Quote:
... blood plasma was collected at 9 am and ELISA kits were used following manufacturer’s instructions (Leptin: Crystal Chem, 90030; GLP-1: Sigma, EZGLP1T-36K; GDF-15: R&D Systems, MGD150; Adiponectin: Crystal Chem, 80569 ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... to check for variability over time and ii) a one-way (GVS: LGVS vs. RGVS vs. Sham) ANOVA on the averaged proprioceptive drift values of the two visual capture conditions ...
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).