-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
King L. Hung, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were diluted 1:4 in hybridization buffer (Empire Genomics) and added to the sample with the addition of a slide ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Africa Fernandez-Nasarre, et al.,
bioRxiv - Immunology 2023
Quote:
... Keratinocytes were cultured in an incubator at 5% CO2 at 35°C in 6-well plates (Falcon) coated with PureCol bovine collagen I solution (Cell Systems) in low calcium homemade culture medium containing recombinant mEGF (Peprotech ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Yongle Chen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were pretreated by overnight incubation at 37°C with a 10 µL mixture of 5 ng/µL dodecyl-beta-D-maltoside (DDM, J&K Scientific, China) and 1 ng/µL trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Boris Botzanowski, et al.,
bioRxiv - Neuroscience 2023
Quote:
TI stimulation was delivered from 8 stimulators via 8 electrode pairs - specifically 16 standard ECG electrodes (Medi-Trace 230, Ambu, Denmark) arranged in a ring around the existing acrylic implant (Fig ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Baylee J. Russell, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 1 mL of sterile deionized water was added to each sample along with one sterile chrome bead (Neta Scientific, Hainesport, NJ). Samples were homogenized for 2 min ...
-
No products found
because this supplier's products are not listed.
Louis Reot, et al.,
bioRxiv - Immunology 2023
Quote:
Chlamydia trachomatis serovar D (D/UW3/Cx) was obtained from Statens Serum Institut (Copenhagen, Dr Follmann laboratory). A2EN cells were seeded in EpiLife medium with EDGS ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
J. Roman Arguello, et al.,
bioRxiv - Neuroscience 2020
Quote:
Antennae from ∼2000 flies (∼1-8 days old) of the desired genotype were harvested by snap-freezing flies in a mini-sieve (Scienceware, Bel-Art Products) with liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Brigitta M. Laksono, et al.,
bioRxiv - Microbiology 2022
Quote:
... or fluorescein-labeled Sambucus nigra lectin (SNA) (5 μg/ml; EY Laboratories; BA-6802-1), respectively ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Xiangtian Tan, et al.,
bioRxiv - Systems Biology 2022
Quote:
... selection with 8 μg/ml puromycin (AG Scientific cat. no. P-1033) began ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Ty S. Maughon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and one induced pluripotent stem cell derived MSC cell-line (Cellular Dynamics International, Madison WI) (Lot #0003 ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
Cat# AB-312,
100 micrograms,USD $565.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... anti-p75 conjugated saporin (p75-saporin) or IgG-saporin control (n = 8 / group, Advanced Targeting Systems) was diluted to final concentration of 0.4 mg/ml in normal saline ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Adam R. Barno, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The six complete circular phages containing at least one AMG were visualized using DNAplotter (Carver et al., 2009).
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
Recombinant AAV-8 VP3 Protein, fused to His-tag, was expressed in E. coli.
Cat# VP3-318A,
10ug , USD $298
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Serena Gea Giannelli, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Cells were lysed in hypertonic buffer (40 mM Tris, 500 mM NaCl, 2 mM MgCl2, pH=8) containing 100U/ml Salt Active Nuclease (SAN, Arcticzymes) for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Yara Eid Mutlak, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phospho-Serine antibody was from ECM biosciences (Cat# PP2551, lot# 5). Anti-Laminin (Cat# L9393 ...