-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Jonathan A Flores, et al.,
bioRxiv - Biophysics 2020
Quote:
... Amino acids corresponding to the intracellular loop (ICL; residues 110–136 in sheep Cx46 and residues 110–148 in sheep Cx50 ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Heng Lin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HEK cells were transfected with 2-3 μg of the designated construct or empty vector using the PolyJet (SignaGen Laboratories, SL100688).
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
All fluorenylmethyloxycarbonyl (Fmoc)-protected amino acids were purchased from Oakwood Chemical or Combi-Blocks ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and p-SCN-Bn-TCMC (S-2-(4-Isothiocyanatobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra(2-carbamoylmethyl)cyclododecane) (catalog No. B-1005) were purchased from Macrocyclics, Inc ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Jordan P. Lewandowski, et al.,
bioRxiv - Immunology 2019
Quote:
... compressed 2” x 2” cotton nestlet (Ancare), and a mouse hut (BioServ) ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... AKT1-2 inhibitor MK-2206 (Targetmol, 1032350-13-2), and everolimus (Targetmol ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Nicole M. Gaudelli, et al.,
bioRxiv - Genomics 2020
Quote:
... and 250IU/mL of recombinant human interleukin-2 (rhIL-2, CellGenix GmbH). Cells were activated with soluble human anti-CD3 (clone OKT3 ...
-
No products found
because this supplier's products are not listed.
Parbir S. Grewal, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Oleate induction media was prepared as 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Spectrum Chemical); 2 g/L Drop-out Mix Synthetic minus appropriate amino acids ...
-
No products found
because this supplier's products are not listed.
Seiji N. Sugiman-Marangos, et al.,
bioRxiv - Microbiology 2021
Quote:
... ARN8 HBEGFKO cells were transfected at 80% confluence in a 6-well plate with pCMV-hHBEGF (2 µg) and PB Transposase vector (0.5 µg) (System Biosciences) using FuGENE® HD (Promega ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Tomáš Urban, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Tissue fragments were then homogenized by 5-6 slow strokes up and down with 2 mL Potter-Elvehjam teflon/glass homogenizer (clearance 0.25 mm; Wheaton™, Millville, USA) driven by electric motor homogenizer (750 rpmi ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jordana Griffiths, et al.,
bioRxiv - Immunology 2020
Quote:
... Histogram overlays were produced using FCS Express (V.3) software (De Novo Software).
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Renee L. Hajnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-2-APC (Tonbo bioscience, 20-7021) on ice for 30 min ...
-
No products found
because this supplier's products are not listed.
Nairi Hartooni, et al.,
bioRxiv - Biophysics 2021
Quote:
... E2 was charged at 37°C for 30 min (for yeast: reaction contained mg/ml Uba1, 2 mg/ml Ubc4, 2 mg/ml methylated ubiquitin from Boston Biochem #Y-501 ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Mahmoud Suliman, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Dialysis was performed against deionized water using Spectra/Por 3 dialysis membrane tubing (Repligen) with a MWCO of 3.5 kDa for 48 hours ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...