-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
Cat# G209,
USD $10.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... IMPACT Mouse FELASA and MKPV testing and was authenticated by CellCheck human 9 Test (9 Marker STR Profile and Inter-species Contamination Test) (IDEXX Analytics, Kornwestheim, Germany). H295R cells stably expressing a doxycycline inducible β-Catenin shRNA (pTer1 shRNA vector ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
Claudin-6/9 (CLDN6/9) Antibody is a Recombinant Human Monoclonal antibody for the detection of...
Cat# abx349889-100UL,
100 µl USD $464.0
Ask
Michaela Frolikova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted 1:50 in 1% BSA in PBS and rabbit polyclonal anti-Folate receptor 4 (Juno) (abx102438, Abbexa, UK) diluted 1:50 in 1% BSA in PBS followed by 1 hr ...
-
No products found
because this supplier's products are not listed.
Tae-Wuk Kim, et al.,
bioRxiv - Plant Biology 2019
Quote:
... or 15N MS medium (1/2 MS without nitrogen source [PhytoTechnology Laboratories] ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Jacqueline Grimm, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Membranes were then incubated overnight at 4 °C with anti-LPS antibody (1:400,000; Hycult Biotech) in milk ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 CaCl2, 30 D-glucose) equilibrated with carbogen (95% O2, 5% CO2) by a peristaltic pump (Dynamax RP-1, Rainin Instrument Co; Emeryville CA, USA). As previously published (figure 6a (Huff et al. ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Carbonyl Fe powder (5-9 μm) was purchased from STREM Chemicals (Newburyport, MA, USA). Fe2O3 nanopowders (50-200 nm ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Hemant K Srivastava, Sharba Bandyopadhyay,
bioRxiv - Neuroscience 2020
Quote:
9 animals were injected with 200 nl of green retrobeads (Lumafluor) into OFC and 3 of them were also injected with 100 nl of anterograde tracing AAV.CB7.CI.mCherry in MGBv using Nanoject II ...
-
No products found
because this supplier's products are not listed.
King L. Hung, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were diluted 1:4 in hybridization buffer (Empire Genomics) and added to the sample with the addition of a slide ...
-
No products found
because this supplier's products are not listed.
Michael Manoharan Valerio, et al.,
bioRxiv - Immunology 2023
Quote:
... and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9). Guide-RNA sequences targeting mouse β2m ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
John F. Tuddenham, et al.,
bioRxiv - Neuroscience 2022
Quote:
6 µM tissue sections were deparaffinized with CitriSolv Clearing Agent (Decon Laboratories, Inc., 1601) for 20 min at room temperature (RT) ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...