-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Kristen R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and 11-nor-9-Carboxy-Δ9-THC (Cerilliant T-018-1ML) was prepared with concentrations of 3 analytes ranging from 781 pg/ml to 100 ng/mL ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Maria Vias, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Y27632 (9 μM, Abmole).
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... or 9 U Isopol SD+ (ArcticZymes). Reaction temperatures and times for these polymerases were ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Michael T. Patterson, et al.,
bioRxiv - Immunology 2023
Quote:
... DiI-oxLDL (Kalen Biomedical, Cat#: #770282-9) was added at 10 μg/ml for 4 hours at 37ºC ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Jutamas Uttagomol, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were plated and grown for 1∼2 days on collagen-coated BioFlex 6-well culture plates with flexible silicone elastomer bottoms (BF-3001C, Flexcell® International Corporation). Each plate was placed over the loading station containing 6 planar faced posts ...
-
No products found
because this supplier's products are not listed.
Richard L Youngblood, et al.,
bioRxiv - Bioengineering 2019
Quote:
... placed on a 9-Position stir plate (Chemglass) set at rotation rate of 95 rpm in a 37°C incubator ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Estifanos N. Habtemichael, et al.,
bioRxiv - Physiology 2019
Quote:
... 100 μl of resuspended cells and 2-4 μg of desired plasmid DNA in 5 μL of volume were pipetted into electroporation cuvettes (2 mm gap, Bulldog Bio 12358-346) and electroporated using a NEPA21 electroporation system ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Julia I. Ries, et al.,
bioRxiv - Microbiology 2022
Quote:
... Formation of the MAC was detected by using a monoclonal anti-C5b-9 antibody (1:500) (Quidel, San Diego, CA, USA) followed by HRP-conjugated anti-mouse IgG (1:1,000) ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Layla Drwesh, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 °C) and the supernatants were incubated overnight with 2 mL Ni-NTA Agarose beads (Cube Biotech). The bound proteins were washed with 20 mL wash buffer (40 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
Recombinant Antigen
Cat# DENVX4VLP-100,
4 x 100µg USD $3067.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Emily G. Kuiper, et al.,
bioRxiv - Biochemistry 2019
Quote:
... aeruginosa PAO1 EF-Tu (tufB) coding sequence from plasmid pJP04 (9) into the pE-SUMO vector (LifeSensors). This construct produces His6-SUMO-EF-Tu protein (“SUMO-L0-EF-Tu” ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Laura M. Chambers, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cells were plated at 65 % confluence in a 100 mm dish and cultured in 9 mL DMEM supplemented with heat inactivated 10% FBS (Atlas Biologicals Cat # F-0500-D, Lot F31E18D1)[15] ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... and went through overnight staining at 4°C with anti-BrdU (1:300, rat, Accurate Chemical Co. #OBT0030). On the second day ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Lazar Novaković, et al.,
bioRxiv - Plant Biology 2022
Quote:
dek1-4 pCESA3:GFP:CESA3 plants were transferred to MS 1% sucrose media supplemented with Plant Preservative Mixture (Plant Cell Technology, Washington DC, USA) diluted in ratio 1:1000 after CESA imaging ...
-
No products found
because this supplier's products are not listed.
Kate M. MacDonald, et al.,
bioRxiv - Cell Biology 2022
Quote:
MCF10A cells were cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Wisent Bioproducts cat #098150), 20 ng/ml human EGF (Cedarlane Labs cat #AF-100-15) ...