-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA, Click Chemistry Tools > 95%), Click-IT™ Fucose Alkyne (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Dong Wang, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Emma R. Scaletti, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for NUDT15 and 8-oxo-dGDP (Jena Bioscience, NU-1158) for NUDT18 ...
-
No products found
because this supplier's products are not listed.
Elyse M. Digby, et al.,
bioRxiv - Biophysics 2021
Quote:
4’,6-Diamidino-2-phenylindole 2HCl (purchased from Biosynth Carbosynth, 1 eq., 0.0100 g, 0.029 mmol) was dissolved in 1:1 distilled water/acetone (1 mL) ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Dailu Chen, et al.,
bioRxiv - Biophysics 2022
Quote:
... with a heated stage and 50 fields of view were imaged under 4′,6-diamidino-2-phenylindole (DAPI) and FITC channels at ×60 magnification (Nikon ×60/0.95 ...
-
No products found
because this supplier's products are not listed.
Maria Skazina, et al.,
bioRxiv - Pathology 2020
Quote:
... Hemocytes stained with 4’-6-diamidino-2-phenylindole (DAPI) were analyzed on a CytoFLEX flow cytometer with CytExpert software (Beckman-Coulter, USA). Plots of side scatter SSC-A versus forward scatter FSC-A were used for visualization of cell groups ...
-
No products found
because this supplier's products are not listed.
Shang Shen, et al.,
bioRxiv - Microbiology 2023
Quote:
... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
No products found
because this supplier's products are not listed.
Justin M. Westerfield, et al.,
bioRxiv - Biophysics 2021
Quote:
... the peptides were labeled at their N-terminus with an amine-reactive environmentally sensitive fluorescent reporter, Succinimidyl 6-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)hexanoate (NBD-X, SE) (AnaSpec, Fremont, CA) [37] ...
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Miqdad O. Dhariwala, et al.,
bioRxiv - Immunology 2020
Quote:
... and skin was minced finely with dissection scissors and mixed in a 6-well plate with 3 ml of digestion buffer consisting of 0.8 mg/ml Collagenase Type 4 (4188; Worthington), 0.02 mg/ml DNAse (DN25-1G ...
-
No products found
because this supplier's products are not listed.
Ryann M. Fame, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5–10 μL of CSF or serum was extracted in 4:6:3 chloroform:methanol:water mixture supplemented with isotopically labeled T3 and T4 (at 100 nM, Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Martin Baccino-Calace, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Larvae were dissected and sharp-electrode recordings were made from muscle 6 in abdominal segments 3 and 4 using an Axoclamp 900A amplifier (Molecular Devices). The extracellular HL3 saline contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Amédée Renand, et al.,
bioRxiv - Immunology 2020
Quote:
... sequences [SLA (p1-p53)] or 0.6 nmol/mL PepTivatorR Candida albicans MP65 (peptides pools of 15 amino acids length with 11 amino acid overlap, Miltenyi Biotec) in 5% human serum RPMI medium in the presence of 1µg/ml anti-CD40 (HB14 ...
-
No products found
because this supplier's products are not listed.
Shulan Xiao, Saumitra Yadav, Krishna Jayant,
bioRxiv - Neuroscience 2022
Quote:
... 4 to 6 MΩ borosilicate patch pipette (Sutter Instruments, CA, USA) were pulled using a P1000 pipette puller (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Genetics 2020
Quote:
4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
No products found
because this supplier's products are not listed.
Rachel E. Young, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cells were assayed using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium reduction assay (BioVision, Milpitas, CA) according to manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biophysics 2023
Quote:
... the cells were stained with 200 μL of 5 mg/mL solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stain (Research Products International) in PBS ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Eva Dervas, et al.,
bioRxiv - Pathology 2020
Quote:
... followed by a 15 min incubation with DAPI (4′, 6-diamidino-2-phenylindole, Novus Biologicals; 1:10,000 in PBS). Sections were washed twice with distilled water ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Michael Brandon Ware, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-IL-6 or anti-CTLA-4 antibodies (BioXCell). For CXCR3 blockade studies ...
-
No products found
because this supplier's products are not listed.
Jue Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... Cells were then washed and counterstained with 4’,6-diamidino-2-phenylindole (DAPI) Vectashield mounting medium and imaged by laser confocal fluorescence microscopy (Olympus).
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Conor J. Sugden, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The skin was then dissected into 2-3 mm2 pieces using a surgical scalpel and 3 or 4 pieces placed per well of a 6-well dish (Greiner Bio-One, Kremsmünster, Austria) with the dermis in contact with the dish ...
-
No products found
because this supplier's products are not listed.
LN Marziali, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cells were incubated with 4’,6-diamidino-2-phenylindol (DAPI; 1 μg/ml) and the corresponding Alexa Fluor-conjugated secondary antibodies (1:500; Jackson ImmunoResearch Laboratories) for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Sophie Lanciano, et al.,
bioRxiv - Genomics 2023
Quote:
Two micrograms of genomic DNA were sonicated for 6 cycles (6 s on, 90 s off) at 4 °C with a Bioruptor NGS (Diagenode), generating average fragments of 1 kb ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
Building Block
Sold for research purposes only.
Cat# 1284.0, SKU# 1284-1000 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Jae Won Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 3-oxo-DCA were purchased from Steraloids (Newport, RI, USA). Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Michele Bortolomeazzi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Akoya Biosciences) and coverslipped using ProLong Gold antifade mounting media (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
Logan D. Morton, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and O-(1H-6-Chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU) coupling reagent (99.9%, Chem-Impex International, Inc.), and a ten-fold excess of N-methylmorpholine (99% ...
-
No products found
because this supplier's products are not listed.
P.K Smitha, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Hydrolysis of (7-methoxycoumarin-4-yl) acetyl-Ala-Pro-Lys(2,4-dinitrophenyl) (Mca-APK-DNP; Enzo Life Sciences) was used to quantify MFcS2 peptidase activity ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... and three 3–4 mm sterile glass beads (Biospec Products). Next ...