-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
Aldosterone ELISA / assay Kit
Cat# K052-H5,
1.0 ea, USD $1285.0
Ask
Cedric Zimmer, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
Steroids were extracted from plasma samples using a triple ethyl acetate extraction and then corticosterone levels were determined using an enzyme immunoassay kit (DetectX Corticosterone, Arbor Assays: K014-H5) previously validated for tree swallows (Taff et al. ...
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Katherine Lee, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 4-week old females were stimulated by intraperitoneal injection of 5 IU pregnant mare serum gonadotropin (PMSG; Lee BioSolutions, 493-10), ovaries were harvested 48 hours after PMSG injection ...
-
4-Bromo-1-butene is a chemical reagent.
Cat# abx183526-25G,
25 g USD $130.5
Ask
Michaela Frolikova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted 1:50 in 1% BSA in PBS and rabbit polyclonal anti-Folate receptor 4 (Juno) (abx102438, Abbexa, UK) diluted 1:50 in 1% BSA in PBS followed by 1 hr ...
-
No products found
because this supplier's products are not listed.
Briana C. Bywaters, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were then seeded (passage 5) on soft (4 kPa) or stiff (50 kPa) polyacrylamide hydrogels coated with 0.2% collagen I (Matrigen, San Diego, CA) at a density of 40x104/18mm2 and cultured for 24 hours ...
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... overnight at 4 °C and then HRP-conjugated secondary antibody (1:2000, ZEN BIO, China) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 5 µg/mL HIV-1 JR-CSF gp120 (Immune Technology) in coating buffer ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Adam G. Maynard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and resuspended in 150 μl of porphyrin extraction buffer (1:4 ratio of 1.7 M HCl:ACN, 1μM deuteroporphyrin IX (Frontier Scientific, D510-9)) and 0.5 μM isotopically labeled amino acids (Cambridge Isotopes ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Johanna F. Dekkers, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 μM Y-27632 (Abmole), 5 nM Heregulin β-1 (Peprotech) ...
-
No products found
because this supplier's products are not listed.
Alexa M. Schmitz, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... was cultured in yeast peptone mannitol (YPM; 5 g L-1 yeast extract (C7341, Hardy Diagnostics, Santa Maria, CA), 3 g L−1 peptone (211677 ...
-
No products found
because this supplier's products are not listed.
C Colomer-Winter, et al.,
bioRxiv - Microbiology 2019
Quote:
... wells were coated overnight at 4°C with 100 µg ml-1 human fibrinogen free of plasminogen and von Willebrand Factor (Enzyme Research Laboratory). The next day ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Haploid integrants were then isolated based on resistance to 5-fluorourotic acid (5-FOA) (United States Biological; F5050) and integration of the cdc15 mutations was verified by growth on selective media followed by PCR and DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Sachiko Haga-Yamanaka, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HDAC 4 (50064 and 50076, BPS Bioscience, San Diego, CA), according to the manufacturer’s instructions ...
-
Recombinant Antigen
Cat# DENVX4VLP-100,
4 x 100µg USD $3067.0
Ask
Richard S Tedder, et al.,
bioRxiv - Microbiology 2019
Quote:
Recombinant DV NS1 antigens (rDVNS1Ag) from the four serotypes (DV 1-4 inclusive) expressed in mammalian cells (The Native Antigen Company, Kidlington, Oxfordshire, OX5 1LH, UK) were used in molar excess as components of the conjugate diluent.
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
Zheng Han, et al.,
bioRxiv - Bioengineering 2019
Quote:
... into a 6-ml ISOLUTE® Single Fritted Reservoir column with 10 μm polyethylene frit (Biotage, Charlotte, NC, USA), followed by washing with 5 mL PBS ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... the mechanosensitive cation channel inhibitor (e.g., Piezo1, TRPC1/6) GsMTx4 (Abcam or Peptide Institute, 2.5 μM, 15-min incubation)l the intracellular calcium chelator BAPTA-AM (Tronto Research Chemicals ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Gregory J. Smith, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
PBS or clodronate (5 mg/ml) containing liposomes (Liposoma, Amsterdam, The Netherlands) were administered to mice by oropharyngeal aspiration on day 5 of the ozone exposure protocol ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Maciej M. Jankowski, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the outer panels of every third section contain two nose-poke ports (Fig 2; a total of 12 ports in 6 sections, SPECIAL.090-SE v1.0, LaFayette-Campden Instruments, Loughborough, UK). One of the two ports in each section is connected to a liquid pump and the other to a pellet dispenser ...
-
No products found
because this supplier's products are not listed.
Jens C. Luoto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... both packed with 5 μm ReproSil-Pur 200 Å C18 silica particles (Dr. Maisch HPLC GmbH). The peptides were separated using a 60 min gradient (5-42 % B in 50min ...
-
Cat# H6A313-1,
USD $335.0/ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-UL44 mAb (Virusys Corporation, #P1202-1; 1:100); α-pp65 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Teodor E. Yordanov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Sodium Hyaluronate (1-1.8MDa) (Lifecore Biomedical; HA15M-1), Hyaluronidase from Streptomyces hyalurolyticus (Sigma Aldrich ...
-
Cat# F6,
USD $18.00/EA
Ask
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli antisera (1:2,000 or 1:5000; BioDesign International).
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...